1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kay [80]
3 years ago
15

Which of these descriptions involves an example of a nonrenewable resource?

Biology
1 answer:
Allisa [31]3 years ago
5 0

Answer:

Kaolin

Explanation:

Trees, wind, and solar energy are all renewable resources.

You might be interested in
Q6.4. You are studying a population of wild coyotes and notice that every three years there is an epidemic of a bacterial
Setler79 [48]
I think it’s a or c but I’m not good at these types of things
5 0
1 year ago
Explain what are ethics.<br> What are your feelings toward HeLa cells? (in at least 4 sentences)
denpristay [2]

Ethics are principles that govern a person’s behavior or the conducting of an activity

4 0
3 years ago
Read 2 more answers
What makes up scientific argument
Wewaii [24]
The major ingredient of scientific argument is scientific evidence and known science concepts. Thus through scientific idea, expectations and observations a scientific argument is given birth to. Scientific argument are usually arrived at by mean of scientific methods. 
5 0
2 years ago
Read 2 more answers
Warning coloration is an example of what kind of behavior?
damaskus [11]
Its defensive, warning coloration is bright colors. Such as poisonous dart frogs, they are brightly colored in order to warn predators they are poisonous 
7 0
3 years ago
Read 2 more answers
This change in the gene pool is a result of hybridization. In scientific terms, we could call this a method of
serg [7]
It can be termed as diversification
3 0
3 years ago
Read 2 more answers
Other questions:
  • The _______________ completely covers the surface of the protoplasm.
    8·1 answer
  • The animals that live in this valley have basic needs to survive. ALL BUT one of these non-living features is a basic need of th
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The secondary structure of proteins results because of _____ bonding between molecules in the protein molecules' backbone.
    15·1 answer
  • What neuronal action occurs at the pyramids of the medulla oblongata? what neuronal action occurs at the pyramids of the medulla
    5·1 answer
  • Shamash is the god of?
    5·2 answers
  • How might the manipulation of DNA or RNA be used to treat disease?
    9·1 answer
  • Question 15 of 20
    5·2 answers
  • Which one of the following records the distance traveled by a vehicle?
    15·2 answers
  • The Linnaean suborder prosimians includes Group of answer choices diurnal and nocturnal lemurs. diurnal and nocturnal galagos. o
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!