Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Answer:
If the amount of predators in the mice environment increased, the mices carrying capacity would_Decrease____. (Increase/Decrease) because.
Explanation:
<h2>please mark me brainliest please</h2>
D or "The park will provide a habitat for many species of Flora and Fauna"
Answer:
Shadows are longest in the early morning and late afternoon/early evening when the sun appears low in the sky. As the Earth rotates on its axis, the sun hits each location in the morning at an angle. ... As Earth continues to spin toward sunset, the increasing angle causes shadows to lengthen!
Explanation:
Hope this helps! Have a good day!.....or not...its up to you- <3
Development region is a designation for a territorial entity.
