The correct answer is: oxaloacetate
Anaplerotic reactions are chemical reactions that form intermediates that can be used in the further steps of metabolic pathways. These reactions are very important, because it is crucial for the cell to regulate concentrations of TCA cycle metabolites and intermediates.
The reaction in which pyruvate is converted to oxaloacetate is catalyzed by pyruvate carboxylase and it occurs in mitochondria. Also, pyruvate can be converted to L-malate, in a similar way.
Answer:
C
Explanation:
Bulls are a more extreme version of a cow. A cow is like a mother who cares for her children while a bull is like a rowdy person who does weird and unpredictable things at times. That's why when people hear the word wild cow, they don't usually get frightened but when they hear the word wild bull, they kind of get afraid.
The answer is A.They contain different genes
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
