All categories

4 years ago

1. When during the cell cycle is a cell’s DNA replicated?

Biology

2 answers:

Llana [10]4 years ago

4 0

Answer: The correct answers are-

1) C) S Phase

2) A) prophase, metaphase, anaphase, telophase.

Cell cycle corresponds to the division of cell, which occurs primarily through two phases that are - Interphase ( which has G1, S, and G2 phase) during which cell grows, duplicates its genetic material and M ( mitotic phase) phase during which cell divides.

S phase ( synthesis phase) corresponds to the duplication of the genetic material (DNA). It takes place place after G1 ( Gap 1 phase) phase.

2) Mitosis is a type of cell divison in which one parent cell divides to produce two daughter cells with same number of chromosomes. Prophase is the first phase, followed by metaphase, anpahse, and telophase.

katrin [286]4 years ago

4 0

1. I believe the correct answer is C. S Phase.

2. I believe the answer is B. interphase, prophase, metaphase, anaphase and telophase

<h2>Explanation:</h2>

The cell cycle is divided into 4 stages i.e. the Gap 1 (G1), Gap 2 (G2), Synthesis (S) and Mitosis (M) stage. The M stage is the longest and has 5 further stages that are interphase, prophase, metaphase, anaphase and then telophase. It is during the S phase that DNA is replicated

<h2>Further Explanation:</h2>

The cell cycle starts with the G1 stage where the cell rests from a previous cycle and also checks for any errors in the DNA. If none were found, it will proceed to the Synthesis (S) phase. In this phase, the chromosomes enter as single strands but come out as double strand due to replication of DNA. The cell cycle enters the G2 phase where for the last time error checking is done to confirm if any errors are present. If any are present, the cycle is terminated and if not, it proceeds to the Mitosis phase. In the M phase, the cell will undergo extensive cell division which starts with the chromatin condensing in the interphase and the nucleus envelope disappears releasing the chromosome pairs. Pairs of chromosomes then emerge in the prophase and food is stored for the division including doubling of cell organelles. Microtubules form in this stage. The cell then enters the metaphase stage where the chromosome pairs arrange themselves at the equator of the cell and held by the microtubules. The microtubules start to shorten and in the anaphase stage, single strands of chromosome are pulled to different poles of the cell and the microtubules then continue to shorten much more further pulling the single strands more towards the different poles. The cytoplasm then starts to pinch into 2 (cytokinesis) and the different sides start forming different nucleus. IN the end of telophase, 2 daughter cells emerge and the M phase ends concluding the cell cycle. The cell again will go into G1 phase to rest and start the next cycle.

<h2>Learn More:</h2>

Learn more about the cell cycle: brainly.com/question/10767798
Learn more about mitosis: brainly.com/question/1982376
Learn more about cell division: brainly.com/question/12326275

You might be interested in

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

netineya [11]

Answer:

The complementary base pair is ATG TTT GTG ATA TGG CGC ATT TAC TAA

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC AAA CAC TAT ACC GCG TAA ATG ATT

ATG TTT GTG ATA TGG CGC ATT TAC TAA

5 0

3 years ago

Unconditional positive regard is a rogerian term for _____.

cestrela7 [59]

Unconditional positive regard is a Rogerian term for: Positive behavior toward a person without attaching any contingencies.
Hope this helps!
<3

4 0

3 years ago

The force that holds the planets in orbit around the sun is called _

Tpy6a [65]

Answer:

Gravity.

Explanation:

Gravity is the force by which a planet or other body draws objects toward its center. The force of gravity keeps all of the planets in orbit around the sun.

Please mark Brainliest! :)

8 0

3 years ago

Read 2 more answers

You use two drugs (sulfisoxazole and trimethoprim) to treat a bacterial infection and notice that bactericidal activity is enhan

mezya [45]

Antagonsitic effect/interaction/response

In order to combat antiobiotic resistance, and to possibly enhance the activity of antibiotics, they are sometimes used in combinations during treatment. However, three possible responses or effects can manifest.

First is antibiotic synergy, where the combined effect of the antibiotics enhances the activity/potency of the treatment compared to when the antibiotics are administered singly.

The effect is also distinguished from another type of response, which is additive effect, where the combined effect of the antibiotics is more or less equal to the combined activity/potency of each of the antibiotic when applied singly. Antibiotic synergy results in even greater enhancement of the activity of the combined antibiotics compared to additive effect.

Lastly, there is the antagonistic effect or response, where the combined effect of the antibiotics results in the weakening of the potencies of the antibiotics relative to the combined (additive effect) potencies of each of the antibiotics.

4 0

3 years ago

when considering the classification of joints based on the shape of the articulating bone ends, the knee functions as a type of

gavmur [86]

According to the research, the correct option is uni-axial synovial joint. When considering the classification of joints based on the shape of the articulating bone ends, the knee functions as a type of synovial joint are called a <u>uni-axial synovial joint</u>.

<h3>What are uni-axial synovial joints?</h3>

They are synovial joints because they have cartilage and a joint capsule that allow flexion and extension movement, and it is because they move in a single plane or axis that they are considered monoaxial.

In this sense, they can be located in the humeroulnar joint located in the elbow, in the femorotibial or knee joint, allowing the rear sides of the leg to be moved away or closer, and finally in the joints that form between the phalanges of the fingers.

Therefore, we can conclude that according to the research, the correct option is uni-axial synovial joint. When considering the classification of joints based on the shape of the articulating bone ends, the knee functions as a type of synovial joint are called a <u>uni-axial synovial joint</u>.

Learn more about synovial joint here: brainly.com/question/28256806

#SPJ1

8 0

1 year ago