1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
2 years ago
9

What are 2 thins cimate change can do if it continues?

Biology
1 answer:
Alinara [238K]2 years ago
5 0
Two things that can occur is water levels may rise and the earth can get warmer.
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
A male who has a normal Y chromosome and an X chromosome for a sex-linked disorder _____ have the disorder.
aev [14]

Answer:

it does not have disorder

5 0
2 years ago
Why are saprotrophs so important to a marine food web?
Darina [25.2K]

Answer:

They break down dead organisms and recycle nutrients. They directly help to maintain the population sizes of different predators. They primarily eliminate toxins from the water that can harm phytoplankton.

Explanation:

Hope it helps I found it on brainly

5 0
3 years ago
Read 2 more answers
Old thermometers contained very small amounts of mercury. The mercury in the photo has a melting point of -38°C. What can u conc
babymother [125]

Answer:

The thermometer can not be used to measure very low temperature

Explanation:

Mercury-in-glass thermometer is one of the types of liquid-in-glass thermometers.

Given the very melting point of mercury, it is unsuitable to attempt to use this thermometer for very low temperature measurement.

Hence, from the melting point of mercury, this thermometer can not be used to measure very low temperature.

6 0
3 years ago
Beetles are typically the first insects present on human remains.<br><br> True<br> False
Ivan
I believe it would be false. Termites are generally the first on human remains. I could be wrong though.
5 0
3 years ago
Read 2 more answers
Other questions:
  • State any five characteristics of bacteria ​
    8·2 answers
  • Biotin and protien do what for the hair
    11·1 answer
  • You discover a new species of ape that is more closely related to gorillas than to any other species of ape, but walks upright.
    8·1 answer
  • Which of the following describes a person swinging a bat?
    5·2 answers
  • The rock cycle is not important to living organisms.
    9·1 answer
  • a rock is dropped from a height of 60 m and is in free fall. What is the velocity of the rock as it reaches the ground 3.5 secon
    11·1 answer
  • In humans brown eyes are dominant to blue eyes. A cross between a heterozygous brown-eyed individual and a homozygous blue-eyed
    9·1 answer
  • CAN SOMEONE PLEASEEEE HELP ME WITH THIS SCIENCE QUESTION THANK YOU:)
    14·1 answer
  • What is the main issue with traditional classification?
    5·1 answer
  • Compare the four types of cells animal, plant, protest, bacteria, what structures do they have in common
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!