It is false that to study Earth’s interior, geologists often rely on indirect methods, such as evidence from fossils. They rely on seismic waves and such.
Explanation:
No, they use seismic waves.A seismic wave is an elastic wave caused by an pressure such as an earthquake or an explosion. Seismic waves may travel either along or near the earth's surface (Rayleigh and Love waves) or by the earth's interior (P and S waves).
Producers like plants and algae that make there own food
Answer:
B. phagocytes
Explanation:
Phagocytosis is a process wherein a cell binds to the item it wants to engulf on the cell surface and draws the item inward while engulfing around it. The process of phagocytosis often happens when the cell is trying to destroy something, like a virus or an infected cell, and is often used by immune system cells.
Answer:
If the genes were linked, the phenotypic and genotypic ratios would be different from 1:1:1:1. The observed proportions in the F1 would be different than the expected ones if genes would assort independently.
Explanation:
Due to technical problems, you will find the complete answer and explanation in the attached files
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
