1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AysviL [449]
3 years ago
6

1) How has the classification of living things have changed over time?

Biology
1 answer:
skad [1K]3 years ago
4 0
1) Because we are constantly discovering new species of organisms, the system of classification is growing.

2) In order for scientists to write, learn, and retrieve data about organisms, there most be an organized filing system in place.
You might be interested in
Check all that apply as characteristics of myelinated axons. Check All That Apply Myelinated axons transmit nerve impulses via c
stiv31 [10]

Answer:

Myelinated axons utilize fewer voltage-gated channels than unmyelinated axons of the same length and diameter.

Myelinated axons are more energy efficient than unmyelinated axons.

Explanation:

Neurons are cells that specialize in transmitting messages to each other using a type of electrical signal. These signals carry information from outside your body to the brain, while others are the instructions for the various organs, glands and muscles to carry out functions.

Neurons receive these signals from other neighboring neurons through their dendrites. The signal then travels to the soma of the neuron, which is the main body of the cell, and finally<u> travels down the axon to the synaps</u>e (space between the end of a neuron and another cell). The axon is a neuronal extension through which the electrical signal travels, extending from the soma to other neurons.

<u>There may be layers of myelin, which consist of a layer of fat, covering the axons and where they have the function of acting as insulators to help keep the electrical signal inside the cell, which makes it move faster increasing the speed of transmission of the nerve impulse</u>.

1) Myelinated axons transmit nerve impulses via continuous conduction. FALSE. In the axon, nodes of Ranvier are found at regular intervals along the length of the axon in the myelin sheath that surrounds it. These are small spaces that expose the axon membrane to the extracellular fluid and serve to allow the nerve impulse to travel faster, in a jumping manner and with less chance of error.

2) Myelinated axons transmit nerve impulses in the same manner as unmyelinated axons. FALSE. In an unmyelinated axon, the movement of voltage across the membrane is due to ion flux that is limited by the time it takes for sodium ions to diffuse into the axon. Myelinated axons conduct faster because they are shorter than unmyelinated axons. In the latter, transmission is continuous but slower.

3) Myelinated axons utilize fewer voltage-gated channels than unmyelinated axons of the same length and diameter. TRUE. The action potential conduction jumps from node to node, thereby they need fewer voltage-gated channels. Unmyelinated axons need voltage-gated channels in along the entire axon.

4) Myelinated axons are more energy efficient than unmyelinated axons. TRUE. The rate at which sodium input through one node can depolarize the axon at the next node is related to the current and capacitance across the membrane. Myelinated axons have faster action potential conduction because it jumps from node to node, thereby they use less energy because they don't have to travel the entire length.

5) Myelinated axons would be unaffected by diseases that attack the CNS. FALSE. For example, Multiple sclerosis (MS) is a demyelinating disease of the CNS in which the immune system attacks the myelin sheath or the cells.

6 0
3 years ago
The presence of a mutualist might allow what to happen in terms of population dynamics? a) The species could surpass its carryin
patriot [66]
B is the right answer
3 0
3 years ago
How do I make this double displacement
kirill [66]

Answer:

NaOH + HCl -> NaCl + H2O

Explanation:

balanço de 1:1

5 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Please only answer if youre sure
Anna71 [15]
The answer is recessive

3 0
3 years ago
Read 2 more answers
Other questions:
  • What are some problems that can occur from an altered gene that makes hemoglobin?
    13·1 answer
  • Investigation: how does temperature affect respiration rates of fish? answers
    6·1 answer
  • What is a radical ?
    6·1 answer
  • How is cellular respiration different from photosynthesis?
    9·2 answers
  • The pathophysiology of heart failure involves an interaction between decreased pumping ability and the ________ to maintain card
    9·1 answer
  • Give three examples of how humans have a positive impact on the environment
    11·1 answer
  • Elaine feels that her life is empty. she has lost interest in career and hobbies, and she wonders if she would be better off dea
    7·1 answer
  • Replication is performed prior to what
    11·1 answer
  • Which part of a nucleotide makes it possible for a nucleic acid to be a unique code
    5·1 answer
  • Is there a relationship between earth's different climates?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!