1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veseljchak [2.6K]
3 years ago
8

The junction between two communicating neurons is called a _____________; there is a _________ _________ between them across whi

ch the impulse must be conveyed. Synaptic transmission it the process by which the impulse in the presynaptic neuron is transmitted across the synaptic cleft to the postsynaptic neuron. When an impulse reaches the synaptic knob of an axon, synaptic __________ release chemicals called __________ into the synaptic _________. These chemicals react with specific receptors on the postsynaptic membrane.
Biology
2 answers:
slamgirl [31]3 years ago
8 0

Answer:

Explanation:

In the nervous system, a synapse is a structure that permits a

neuron (or nerve cell) to pass an electrical or chemical signal to

another neuron or to the target effector cell.

Neurotransmitter, also called chemical

transmitter or chemical messenger, any of a

group of chemical agents released by neurons

(nerve cells) to stimulate neighbouring neurons

or muscle or gland cells, thus allowing impulses

to be passed from one cell to the next throughout the nervous

system.

the synaptic cleft is the physical space between these two

neurons. the space that separates a neuron and its target cell at a

chemical synapse.

There are steps involved in synaptic transmission, which usually takes place at the neuromuscular junction.

Synapses may be chemical or electrical. In this case, it is a chemical synapse because it involves the transmission of information via chemical mediators.

The release of neurotransmitter molecules into the synaptic cleft is triggered by the influx of calcium ions via voltage-gated ion channels.

LiRa [457]3 years ago
7 0

Answer:

The junction between two communicating neurons is called a <u>synapse</u>; there is a <u>gap</u> between them across which the impulse must be conveyed. Synaptic transmission it the process by which the impulse in the presynaptic neuron is transmitted across the synaptic cleft to the postsynaptic neuron. When an impulse reaches the synaptic knob of an axon, synaptic <u>vesicles</u> release chemicals called <u>neurotransmitters</u> into the synaptic <u>cleft</u>. These chemicals react with specific receptors on the postsynaptic membrane.

Explanation:

These are the key steps involved in synaptic transmission, which usually takes place at the neuromuscular junction.

Synapses may be chemical or electrical. In this case, it is a chemical synapse because it involves the transmission of information via chemical mediators.

The release of neurotransmitter molecules into the synaptic cleft is triggered by the influx of calcium ions via voltage-gated ion channels.

You might be interested in
What Is The Definition of an Organelle?
goldfiish [28.3K]

Answer:

An Organelle is a specific structure within a cell, and there are many different types of organelles. Organelles are also called vesicles within a cell. Organelles are all membrane-bound

5 0
3 years ago
What is the differece between a bullshark and a sand shark?
astra-53 [7]

Answer:

Explanation:

The bull shark also called the Zambezi shark in Africa is a requiem shark commonly found worldwide in warm, shallow waters along coasts and in rivers. It is known for its aggressive nature, and presence in warm, shallow brackish and freshwater systems including estuaries and rivers. It can thrive in both salt and fresh water and can travel far up rivers.

While the sand shark also known as sand tiger sharks, are found worldwide in temperate and tropical waters, often seen swimming around the ocean floor in the surf zone; at times, they come very close to shore. They are often found in warm or temperate waters throughout the world's oceans, except the eastern Pacific.

8 0
4 years ago
Respiration most like the reverse of
aliina [53]
Respiration is the reverse of Photosynthesis.
5 0
4 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which of the following factors would have the smallest impact on a population’s size? a. the total number of organisms b. the av
almond37 [142]

Answer:

D

Explanation:

adequate shelter, as animals can live without adequate shelter.

8 0
3 years ago
Other questions:
  • There are a lot of endangered animals in this world, and the numbers are increasing constantly as their habitats are destroyed b
    6·1 answer
  • Help please!
    6·2 answers
  • Some scientists theorize that this behavior developed from the tactic of throwing smaller eggs to break them open. ostrich eggs,
    9·1 answer
  • What is the best description of a plant meristem
    8·1 answer
  • Sexual reproduction in animals depends on the production of gametes. Which of these processes produce gametes in animals?
    11·2 answers
  • This illustration shows a kind of animal that is a free-living organism.
    13·2 answers
  • A neap tide is when the tides have a big difference between high and low tide. *
    7·1 answer
  • Tom is a scientist who is observing the rise of sea level every year. How much of a rise in sea level would Tom observe in any o
    5·1 answer
  • GIVING BRANLIEST!!! Which statement accurately describes one aspect of plate tectonics that involves subduction and seafloor spr
    11·2 answers
  • On what basis are minerals divided into groups?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!