1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lys-0071 [83]
3 years ago
13

Which type of transport requires energy?

Biology
2 answers:
tatyana61 [14]3 years ago
7 0
Active transport requires energy. Passive transport does not require energy. In case you did not know active transport is the movement of ions or molecules across a cellular membrane from a lower to a higher concentration.
Hope this helps!
Gennadij [26K]3 years ago
5 0
<span>Active transport, requires ATP energy. 

The other type of cell transport is passive, which allows molecules/atoms to move down their concentration gradient, using no energy.
if it help pick as best tnxxx :)</span>
You might be interested in
The female portion of the flower is the
solmaris [256]
The answer to this question is b carpel that's the answer
4 0
3 years ago
2. What are individual characteristics? Give an example of an individual characteristic?
kvv77 [185]

Answer:

Individual Characteristics are properties of physical evidence that can be attributed to a common source with a high degree of certainty. Examples of individual evidence include anything that contains nuclear DNA, toolmarks, and fingerprints.

Explanation:

4 0
2 years ago
Read 2 more answers
Water molecules stick other molecules. this property is called?
liraira [26]
The property called cohesion
8 0
3 years ago
The ____is a process often used by scientists to help them solve problems
Deffense [45]

Answer:

scientific method

Explanation:

8 0
3 years ago
Read 2 more answers
How long has the water on earth been around?
SSSSS [86.1K]
The study pushes back the clock on the origin of Earth's water by hundreds of millions of years, to around 4.6 billion years ago, when all the worlds of the inner solar system were still forming. Scientists had suspected that our planet formed dry, with high-energy impacts creating a molten surface on the infant Earth.

Answer: 4.6 billion years.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which example best shows conversation of resources
    15·2 answers
  • Which is an example of competition within a species?
    8·1 answer
  • What is structural adaptation
    9·1 answer
  • During a pulse-chase experiment, photographic emulsions were prepared at different times during the chase, and radioactive spots
    5·1 answer
  • ____ is the perceptual organization of a complex acoustic signal into separate auditory events. harmonic sound perception acoust
    5·2 answers
  • A biology student is studying ways to grow crops in soils that are high in salts and other dissolved solids. To determine whethe
    11·2 answers
  • Arrange the following steps that occur during drought tolerance in plants in a correct sequence.
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • 7. Which type of transport below moves water through a selectively-permeable membrane from areas of greater concentration to are
    11·1 answer
  • Waste produced by agriculture, mining, households, industry and other
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!