1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
3 years ago
6

You are asked to smell a solution in a beaker. what is the best way of doing this?

Biology
1 answer:
astraxan [27]3 years ago
3 0
The best way of doing it without potentially causing harm to yourself, would be "wafting". 
You might be interested in
The combining forms​ pareun/o- and​ venere/o- mean:
Rom4ik [11]

Answer:

B. sexual intercourse.

Explanation:

The word is pareunia which means coitus. The sexual union between a male and a female is called pareunia or coitus. Similarly, venerus is a Latin word meaning sexual intercourse between a male and a female. Thus, The combining forms​ pareun/o- and​ venere/o  meaning the sexual act between a male and a female.  

6 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
A gene is a segment of mrna
Viefleur [7K]

Answer:

An RNA single-stranded molecule that is complementary to one of a gene's DNA strands, to be precise.

Explanation:

DNA sequences or segments code for proteins or molecules with defined functions, called genes.

7 0
3 years ago
The ability to detect physical energy through our visual or touch systems
PIT_PIT [208]
Sensation

detection of physical energy by sense organs, which then send info to the brain
- Detection of stimuli by sense organs
- how info gets to our brain = detecting stimuli
- allows us to pick up the signals in our environment
- ex. vision- going through eye to visual cortex and smell - going through nose.







8 0
3 years ago
14. A structure with a chain of carbons and hydrogens with a COOH at the end will represent which of
pychu [463]

Answer:

The correct answer is a Protein

Explanation:

Proteins are macromolecules consisting of amino acids which are joined by peptide bonds.

         Protein molecule has two ends,  amino(-NH2) group is present at one end that is known as amino terminal end or N terminal end whereas carboxyl group is present at the another end that is called carboxy terminal end or C terminal end.

3 0
3 years ago
Other questions:
  • the slowest type of mass movement, which involves the lifting and contracting of soil particles over time , is called
    9·1 answer
  • Which examples describe biotic factors interacting with the environment?
    13·1 answer
  • Which of the following scientists did not contribute to the cell theory? A. Virchow B. Hooke. C. Schleiden D. Newton
    14·2 answers
  • What are spring tides?
    5·2 answers
  • What is the signal to open a voltage gated calcium channel?
    15·1 answer
  • Eukaryotes and prokaryotes are the two main types of cells.
    10·1 answer
  • Some homes have stairs that are too steep or narrow for moving large pieces of furniture. In such cases, furniture may be lift e
    14·1 answer
  • Which process produces diploid cells?<br> A. Mitosis<br><br> B. Meiosis
    11·2 answers
  • (GIVING BRAINLIEST!!!!!!!)
    10·2 answers
  • PLEASE HELP!!!!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!