1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
4 years ago
14

At what stage do decomposers fit into the cycle shown?

Biology
2 answers:
brilliants [131]4 years ago
6 0

Answer:

4

Explanation:

cause when the animals die they rot into the soil

Alex4 years ago
6 0

Answer:

4th stage

Explanation:

Since decomposers decompose or act on dead and decaying matter it would be best suitable for them to be at the fourth stage( Dead organisms and waste products).

You might be interested in
What information is contained in the branches of a cladogram?
Brums [2.3K]

The branching point on a cladogram represents a common ancestor. A cladogram is a diagram used in cladistics to show relations among organisms. However it is not an evolutionary tree since it does not show how ancestors are related to descendants, nor does it show how much they have changed. 
8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Can you recognize the eight stages of meiosis based on the location and behavior of the chromosomes? drag the diagrams of the st
Paul [167]
In meiosis, cell division will occur two times. It shall be called Meiosis I and Meiosis II. And Meiosis happens to our sex cells, egg for female and sperm cells for the male. There four stages in Meiosis I, Prophase I will happen when who homologous chromosomes exchange DNA. Metaphase I will happen when the pair move together in the center. Anaphase I is when the who homologous chromosomes are pulled apart to opposite poles. Telophase I is when the the first division of the chromosomes happen. Producing two 24 chromosomes cells. The nest division will produce haploid or 12 chromosome cells. In Propase II, the nuclear walls will disappear once again, in the Metaphase II the cells will meet again in the center. In Anaphase II the chromatids will be pulled apart. And then lastly in the Telophase II, the chromatids will not be 2 haploids. So in Meiosis, 4 sex cells are produced.
4 0
4 years ago
Which of the following can survive in extreme environments?
Vladimir [108]
<span>D: Viruses

I hope helped ^-^</span>
5 0
3 years ago
A codon, or a group of how many nucleotides, stands for a particular amino acid?
omeli [17]
3 nucleotides code for an amino acid
5 0
4 years ago
Other questions:
  • Sieve tube members better conduct sucrose by ______.
    15·1 answer
  • What is likely to happen to the cells of a marine plant if placed in a fresh water environment?
    15·1 answer
  • ​a species that is found only on one island would be described as ____.
    7·1 answer
  • Can someone explain what an enzyme is?
    14·1 answer
  • The group that includes gorillas, chimpanzees, bonobos, and humans is called the
    8·2 answers
  • Name two Nature given important part of our life
    5·2 answers
  • Im am giving away 70 points or even more all you have to do is brainlist my answer
    8·2 answers
  • Multiple Choice
    12·2 answers
  • Frogs in a certain population can be either green or bright yellow. The green color allows the frogs to blend in with their surr
    14·2 answers
  • Describe the role of white blood cells in fighting diseases and destroying pathogens.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!