It’s C ) Mitochondria-makes energy
Hypothesis: If the tablet is placed in warm water, then the tablet will dissolve faster because an increase in temperature speeds up the dissolving rate of some substances.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The geologic time scale is an important tool used to portray the history of the Earth—a standard timeline used to describe the age of rocks and fossils, and the events that formed them. It spans Earth's entire history and is separated into four principle divisions.
Explanation:
