1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
9

What is the process that phototrophs use to obtain free energy from organic compounds?

Biology
1 answer:
MatroZZZ [7]3 years ago
8 0
Did you mean photoautothrops, if so, the answer is photosynthesis, please tell me if this helped.
You might be interested in
Sergei Winogradsky Choose one: A. discovered microbial fermentation. B. developed a pure culturing system using agar. C. identif
NeX [460]

Answer:

D. Discovered chemolithotrophs in natural enviroments.

Explanation:

Sergei Winogradsky was a russian microbiologist. He observed in his research with genus of bacteria <em>Beggiatoa, </em>they were able to oxidize hydrogen sulfide as an energy source. Being the first example known of lithotrophs (organisms that use inorganic substrate in order to obtain energy).

7 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
A device that uses wire streched across a fault to mesure horizontel movement of ground is called a
schepotkina [342]
<span> A creep meter uses a wire that stretches across a fault to measure horizontal movement of the ground, and a  </span>laser-ranging device uses alaser<span> beam & reflector to detect Horizontal fault movements. I hope this is right.</span>
6 0
3 years ago
The length of bamboo grows much faster than that of thickness why?​
iren [92.7K]

Using a slow- and fast-growing variant of bamboo, Wei and colleagues looked at cell division, growth, and gene expression (through transcriptomics, which measures all the genes being expressed by an individual) to discover which genes may be responsible for fast growth in bamboo. They found that the slow-growing variant had reduced expression of genes relating to cell wall construction, the plant hormone auxin (important for cell growth and cell division), and had irregular cell growth and cell walls. Wei and colleagues suggest that a reduced ability to produce and perceive auxin, combined with a weakened cell wall, are responsible for the slow growth seen in the bamboo variant.

3 0
2 years ago
Musculo que tiene las características tanto de musculo esquelético como de musculo liso. Se encuentra en el corazón y sus contra
Andrei [34K]

Answer:

músculo cardíaco

Explanation:

Los 3 tipos de tejido muscular son 1-músculo cardíaco o miocardio (involuntario), 2-músculo liso (involuntario) y 3-músculo esquelético (voluntario). Las células del músculo cardíaco, las cuales son conocidas como 'miocardiocitos', poseen una apariencia estriada y forman la pared del corazón. Los miocardiocitos son alargados, ramificados, y poseen un núcleo central (son células uninucleadas, a diferencia de las células del músculo esquelético, las cuales son multinucleadas). Además, los micardicitos son más cortos (80 a 100 µm) y más anchos (aprox. 15 µm) que las células del músculo esquelético. Los miocardiocitos presentan uniones especializadas conocidas como discos intercalares, los cuales son un tipo de complejo de unión entre los límites de dos cardiomiocitos. En el citoplasma de los cardiomiocitos se encuentran las miofibrillas, las cuales son estructuras contráctililes que les confieren a las células musculares sus propiedades características de contracción y de elasticidad. En estas células (cardiomiocitos) las miofibrillas se disponen de manera longitudininal con un patrón estriado.

7 0
3 years ago
Other questions:
  • Which statement best explains how a cyclone forms?
    9·1 answer
  • Constance's body is capable of producing insulin, but the insulin is misused. her condition is known as ____.
    9·2 answers
  • What are the three common parts of a nucleotide?
    14·1 answer
  • _refers to a procedure in which the fetus is delivered up to its head and the brain matter is removed A.chemical abortion B.pill
    13·2 answers
  • What is the bond angle between the hydrogen atoms in the ammonia molecule
    7·1 answer
  • What is the diference between the question and hypothesis steps in scientific inquiry? a. The question step provides the questio
    11·1 answer
  • "Housekeeping genes" in bacteria are commonly expressed constitutively, but not all of these genes are expressed at the same lev
    5·1 answer
  • What would happen to the production of the high energy sugars if water or carbon dioxide were not
    15·1 answer
  • Which option identifies a question to consider in the following scenario? Frannie is thinking of breeding her seven-year-old cow
    15·1 answer
  • Anemia is caused by a defective gene resulting in abnormal hemoglobin: a. Hemorrhagic anemia b. Aplastic Anemia c. Pernicous Ane
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!