1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
user100 [1]
3 years ago
12

The usefulness of microvilli to cells that have them is ___________________.

Biology
1 answer:
sveticcg [70]3 years ago
4 0

Answer:

D. to increase their surface area

Explanation:

The usefulness of microvilli to cells that have them is TO INCREASE THEIR SURFACE AREA.

You might be interested in
What are two kinds of fermination?
sp2606 [1]
Two kinds of Fermentation are, Alcoholic and Lactic acid Fermentation.
3 0
3 years ago
What is an ionic compound?
Law Incorporation [45]

Answer:

Ionic compounds are ion compounds. These ions are atoms that gain or lose electrons, resulting in a net positive or negative charge. Metals tend to lose electrons, so they have a net positive charge and become cations. Non-metals tend to gain electrons, creating a net negative charge of anions.

Explanation:

7 0
2 years ago
Fill in the blanks to complete each sentence about dry climates.
Savatey [412]

Dry climates do not have sufficient precipitation during the most of the year.

Desert are located in the arid climate.

The semiarid climate is in a grassland, or steppe, region.

4 0
3 years ago
What do fungi give off after they digest the food that they absorb?
Lera25 [3.4K]
I am not sure but I am guessing carbon and nitrogen :)
6 0
3 years ago
Read 2 more answers
Which statement is False?
timofeeve [1]

Answer:a

Explanation:

4 0
3 years ago
Other questions:
  • Bacteria grow best in food that has a pH factor that is _____.
    12·1 answer
  • In dna replication complementary base pairing occurs between
    14·1 answer
  • HELP HELP PLEASE!!!!!!!
    5·1 answer
  • What is meant by the unexpected consequences of environmental manipulation?
    9·2 answers
  • 8.which of the following is NOT a carbohydrate
    14·1 answer
  • In small quantities, alcohol can be mistaken for a stimulant because it: a. stimulates the sympathetic nervous system b. speeds
    11·1 answer
  • 1. Respiration begins with ____________. 2. Gas exchange is needed to provide cells with the ____________ they need for cellular
    5·1 answer
  • What refers to any instrument or weapon used in a death, such as a knife or firearm?
    11·1 answer
  • No links please, and thank you in advance :)
    10·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!