1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mekhanik [1.2K]
3 years ago
13

What does the "t" in tRNA stand for?A.transB.transferC.translationD.transcription

Biology
1 answer:
Nutka1998 [239]3 years ago
5 0

Answer:

transfer

Explanation:

<u>Transfer</u> ribonucleic acid

You might be interested in
If there are probability of 50% of producing male gamete then what would be the probability of producing transgender. When fathe
Vaselesa [24]

The probability of producing a transgender = None ( D ) when the father is gay

The probability of producing male gamete is not affected by the sexual orientation of the Father because the production of the male gamete is carried by the spermatogonia found in the testes of a male. and every male specie regardless of your sexual orientation have testicles where the spermatogonia undergoes mitotic divisions to produce the male gametes.

Hence the probability of producing a transgender given that the father is gay is non-existent i.e.0%

Learn more : brainly.com/question/11508846

5 0
2 years ago
Read 2 more answers
How are fossil fuels formed?
maria [59]

Answer:

They are made of decayed organisms

Then it's c

Explanation:

C

4 0
3 years ago
13.) A skier on a ski lift is making her way to the top of the ski mountain. As the skier moves higher a. The kinetic energy bei
erik [133]

Answer:

gravitational potential energy

The skier possesses gravitational potential energy at the top of a slope, which transforms into kinetic energy as he moves down the slope.

3 0
3 years ago
When particles may flow freely you have a solid, liquid, or gas ? <br><br> I need the answer please
horrorfan [7]

Answer:

The answer is Gas.

Explanation:

Gas flows freely because the particles are loose and has no restraints.

4 0
3 years ago
Read 2 more answers
About 90% of the neurons in the nervous system are __________ neurons.
katrin [286]

Answer: association neurons

Explanation:

5 0
2 years ago
Other questions:
  • List and briefly describe three other types of specialized, resistant, resting cells produced by bacteria
    14·1 answer
  • How might targeting rapidly growing cells explain common chemotherapy side effects such as hair loss and nausea
    8·2 answers
  • What features would help a plant adapt to a tropical forest biome?
    7·2 answers
  • The transmission electron microscope is most useful for
    8·2 answers
  • Photosynthetic cyanobacteria created what important component of the atmosphere?
    6·1 answer
  • Marine debris mostly originates from oceangoing ships. true or false
    15·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Are pine trees Vascular?????? (25 POINTS) HURRY
    6·1 answer
  • 3. For each of the following chemicals, list the subunit(s). Designate (with a star or asterisk) which
    7·1 answer
  • What is the middle of the ear called
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!