1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
quester [9]
3 years ago
11

Soils through which fluids can easily flow are

Geography
1 answer:
kow [346]3 years ago
4 0
The answer is POROUS because a POROUS material is a material that allows the passage of air or liquid through tiny spaces called pores. Hope i helped. Have a nice day.
You might be interested in
In ΔVWX, w = 6 cm, ∠X=126° and ∠V=51°. Find the length of v, to the nearest 10th of a centimeter.
Alla [95]

Answer:

In ΔVWX, w= 6 cm, ∠X126 degrees and ∠V= 51 degrees. Find the length of V to the nearest 10th of a centimeter

8 0
3 years ago
What region supplied wood to the ancient Egyptians? Nubia Europe Southwest Asia the Sinai Peninsula
Paha777 [63]

Answer:

The sinani penensila if you listen it was that

Explanation:

I payed atention : 0

5 0
3 years ago
The ancient Egyptians did not have ____
zavuch27 [327]
Equality, people had their own place in the social structure
6 0
3 years ago
Which major mountain range meets the Atlantic Ocean? A) the Himalayas B) the Andes C) the Alps D) the Atlas help please
melisa1 [442]

Answer:

d

Explanation:

mark me brainliest pls

7 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • What percentage of North America is covered by forests? 12% 25% 36% 48%
    15·1 answer
  • Which major economic activity in the Middle East occurs largely in the areas circled on the map above?
    10·2 answers
  • How many gps satallites orbit the earth ??
    13·1 answer
  • What type of boundary occurs where two plates move together, causing one plate to descend into the mantle beneath the other plat
    11·2 answers
  • A skateboard ramp had a slope of 2/5. Which is the closest to the angle the ramp make with the ground?
    10·1 answer
  • Please help on my science assignment
    8·1 answer
  • What do the numbers on the yellow lines mean on the surface area map?
    6·1 answer
  • Which of the following statements about transportation costs is true?
    13·2 answers
  • Wich of the following states borders the most other states?
    15·1 answer
  • If you could add an objective to the U.N. Charter, what would you add?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!