1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
swat32
3 years ago
13

Which best explains how photosynthetis is helpful to humans.

Biology
2 answers:
Lady bird [3.3K]3 years ago
7 0
It reduces the amount of harmful rays released by the sun and It increases the levels of carbon dioxide in the air.

Thanks You
Please Mark as Branliest
Olin [163]3 years ago
7 0

Answer:

Photosynthesis produces oxygen which humans need to breath in and produce carbon dioxide which plants and some bacteria take in and use to produce their food that they need.

You might be interested in
Why are cells growing on top of each other even if they have space in culture flask
maks197457 [2]

Answer:in culture plates cell density of the edges is often more than the center of the dish,

what causes this distribution?

Explanation:

8 0
3 years ago
Explain why are the constrllations of the zodiac seen in both boston and brazil?
marishachu [46]

Answer:

Because Circumpolar constellations are constellations that never set below the horizon when seen from a particular location on Earth.

They can be seen in the night sky throughout the year, while other constellations are seasonal, visible only at certain times of year.

The term circumpolar refers to constellations and stars that are circling the north and south celestial poles without ever dipping below the horizon. All circumpolar constellations are found near the celestial poles and, due to their proximity to the poles, they never disappear from view.

The five northern constellations visible from most locations north of the equator throughout the year are Cassiopeia, Cepheus, Draco, Ursa Major, and Ursa Minor.

The three southern circumpolar constellations visible from most locations in the southern hemisphere are Carina, Centaurus, and Crux.

Other constellations are just as prominent in the sky and can be seen for most of the year, but only these eight are circumpolar.

6 0
4 years ago
Move this lichen
Aleksandr [31]

Answer:

1

Explanation:

Lichen are usually the first thing to grow on bare rock, making them a pioneer species. Fun fact, you can use lichen to determine if the air quality in an ecosystem is polluted.

Hope this helped :)

4 0
3 years ago
Osmosis is the movement of water across a membrane to get equal concentrations on either side of the membrane.
kicyunya [14]

Answer:

It is true

Explanation:

4 0
3 years ago
Despite the differences in mature plant cells, all of them are derived from meristem cells. The three major types of tissue syst
zysi [14]

Answer:

A) notocord

Explanation:

5 0
4 years ago
Read 2 more answers
Other questions:
  • Sarah finds herself in the middle of the Amazon rainforest with different ecosystems. What type of ecological unit is she in?
    6·3 answers
  • Name three physical properties of a liquid
    7·2 answers
  • Describe factors that change biodiversity, need helppppp
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Discribe what id meant by the statement cleaner than coal
    8·1 answer
  • Why plants don't need specialized rispiratory system?
    11·1 answer
  • sally took antibiotics for several weeks. how would your gut react to the antibiotics after that long
    10·1 answer
  • FOR THE SECOND TIME-----Ughhh can someone answer this dang biology question I cant!!!!! I will mark you brainliest!!Referring to
    11·1 answer
  • Which of the following is more typical of an animal skeleton?
    13·1 answer
  • What part of your ear
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!