1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artemon [7]
3 years ago
9

I’ll mark brainliest

Biology
1 answer:
dedylja [7]3 years ago
4 0
The correct answer is number 2. The reason is the carbonation in the soda water will eventually stop bubbling and therefore the water molecules will still exist.
You might be interested in
Decomposition of plant and animal matter present in soil is largely due to soil microorganism. True or False
Harman [31]
<span>The question says,'decomposition of plants and animal matter present in the soil is largely due to soil micro organism. The statement is true. The soil microbes function by decomposing the organic matter in the soil to the forms usable to plants. The humus produce by these microbes is largely responsible for soil fertility. </span>
8 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Hello, please help, see attached photo :) thanks
Dmitry [639]

Answer:

a. Parents AA x Aa

b.

                     A               A

A                   AA             AA

a                   Aa              Aa

c. 50%

Explanation:

a. Parents AA x Aa

b.

                     A               A

A                   AA             AA

a                   Aa              Aa

c. 50%

5 0
2 years ago
What normally happens immediately after fertilization in sexual reproduction?
masya89 [10]

Answer:I don’t know this one.

Explanation:but it should be a

3 0
2 years ago
An early winter frost prevents further growth in a tomato garden. The frost is an example of which of the following?
qwelly [4]
Give us Choices, but I’m guessing it’s limiting factor
6 0
2 years ago
Other questions:
  • Who is eligible for care within the veterans health administration?
    12·1 answer
  • Match the numbered terms to the description that follows. Choose all appropriate terms. A prokaryote that obtains both energy an
    10·1 answer
  • In order to achieve sustainability of our environment, several factors must be considered. Which is NOT a factor to achieve succ
    5·2 answers
  • When a____ air mass moves toward a warmer air mass, it causes a cold front. The ____ air rises, leaving ____ temperatures in the
    14·2 answers
  • Do biotic and abiotic ever overlap?
    6·2 answers
  • During what processes would your body use condensation reaction ?
    8·1 answer
  • During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence
    9·1 answer
  • Which measurement is affected by gravity?(1 point)
    6·1 answer
  • Select the correct answer.
    13·2 answers
  • Which is the advantage of water's heat capacity?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!