1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelechka [254]
3 years ago
15

Businesses and organizations can spend money for a candidate without making a direct donation. These donations are known as ____

______. A. soft money B. income taxes C. public funds D. internet funds
Law
2 answers:
patriot [66]3 years ago
6 0

Answer:

A

Explanation:

I took the quiz. :)

Law Incorporation [45]3 years ago
5 0

Answer:

The answer was A. Soft money.

Explanation:

You might be interested in
Mr. Lynn, an agent for Acme Insurance, Inc. thinks that, since state laws are preempted concerning the marketing of Medicare hea
n200080 [17]

What might you, as his colleague, advise him concerning the type of scrutiny he will be under is: d. Organizations sponsoring Medicare health plans are responsible for the behavior of their contracted representatives and will be conducting monitoring activities to ensure compliance with all applicable Federal law and guidance and plan policies. Furthermore, state agent licensure laws are not preempted and he must abide by their requirements.

<h3>What is medicare?</h3>

A medicare can be defined as a health insurance coverage that help to cover medical expenses.

Based on the given scenario what  you might  advise him concerning the type of scrutiny he will be under is that company that is incharge of the medicare plan are the one incharge of the representatives behavior.

Therefore the correct option is D.

Learn more about medicare here:brainly.com/question/1960701

#SPJ1

8 0
1 year ago
HELP PLEASE I DONT NOW WHAT IT IS
zavuch27 [327]

Answer:

Maybe c) is the answer cuz they didn't take any action regarding this issue

8 0
2 years ago
What level of government is in charge of regulating teacher licenses?​
zheka24 [161]

Answer:

State governments

Explanation:

8 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
How did the 1932 Supreme Court case Wood v. Broom affect equal representation in the House?​
castortr0y [4]

Answer:

It limited the House's ability to impose additional standards on representatives. Representative Jones votes for a bill favored by his constituents, although he does not support it.

Explanation:

plz mark me as brainiest

8 0
3 years ago
Other questions:
  • A person who makes a private persons’ arrest must notify the arrested person of this right to protection against self in crimina
    5·1 answer
  • Explain five agencies of education​
    15·1 answer
  • The history of policing in the United States extends back to?
    11·1 answer
  • Why are women less likely to use excessive force than men?
    12·2 answers
  • The Great Compromise proposed by the committee headed by Roger Sherman called for
    12·2 answers
  • What might a national fingerprint database not meet current law enforcement needs and be considered outdated?
    5·1 answer
  • During the 1950s, psychology and social psychological research played key roles in the new focus on prisoner's health and well-b
    8·1 answer
  • What is a democratic republic?
    14·1 answer
  • By what year were there laws against abortion in practically every state in the u. S. ?.
    8·1 answer
  • How might opinion polls negatively affect voter behaviors?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!