1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
11

What are the three classes of bryophytes?

Biology
1 answer:
Margaret [11]3 years ago
3 0

Answer:

Class I: Hepaticopsida ( Liverworts)

Class II: Anthocerotopsida ( Hornworts)

Class III: Bryopsida ( Mosses)

Explanation:

Bryophytes are small plants that grows in moist and shady places.They don't attain great heights because of absence of roots, vascular tissues, mechanical tissues and cuticle. They are terrestrial but require external water to complete their life cycle. Hence they are called as the" amphibians" of the animal kingdom.

Class I: Hepaticopsida or Hepaticae

  • Gametophytic plant body is either thalloid or foliose. If foliose the lateral appendages are  without midrib.
  • Rhizoids without septa
  • Each cell in the thallus contain many chloroplasts
  • Sex organs are embedded in the dorsal surface
  • Capsule lacks columella
  • Sporophyte may be simple having only one capsule or differentiated into root, seta and capsule
  • It has 4 orders: Calobryales, Jungermanniales, Spherocarpales and Marchantiales

Class 2: Anthocerotae or Anthocerotopsids:

  • Gametophytic plant body is simple, thalloid;thallus dorsiventra without air chambers shows no internal differentiation of tissues
  • Scales are absent in the thallus
  • Each cell of the thallus possess a single large chloroplast with a pyrenoid
  • Sporophyte is cylindrical only partly dependent on gametophyte for its nourishment. It is differentiated into bulbous foot and cyclindrical capsule. Seta is meristematic.
  • Endotheciumforms the sterile central column in the capsule. It have ony one order Anthocerotales

Class 3: Musci or Bryopsida

  • Gametophyte is differentiated into prostrate protonema and an erect gametophores
  • Gametophore ids foliose, differentiated into axis and lateral appendages like leaves but without midrib.
  • Rhizoids are multicellular with oblique septa
  • Elaters are absent in the capsule of sporangium
  • The sex organs are produced in seperate branches immersed in a group of leaves.
  • It has only three orders: Bryales, Andriales and Sphagnales

Bryophytes are used as a packaging material for fragile goods, glasswares etc.Mosses are good source of animal food in rocky and snow clad areas. Decoction prepared by boiling Sphagnum in water  is used for the treatment of eye disease.

You might be interested in
The ocean is a carbon oxide directly from the atmosphere how does CO2 are the affect the ocean
vlabodo [156]

Answer:

MRCORRECT has answered the question

Explanation:

After atmospheric carbon dioxide dissolves into the ocean, the aqueous carbon dioxidereacts with seawater to form carbonic acid. As carbonic acid continues to interact with water molecules, carbonate is formed, which increases the concentration of hydrogen ions in the ocean and consequently reducesocean pH.

6 0
3 years ago
You schedule your next fishing trip during the full moon for the peak fishing action. Today marks the third quarter moon phase.
Gala2k [10]

Answer:

b

Explanation:

dffffffffffff

3 0
3 years ago
Read 2 more answers
Organ of sweat is called
DiKsa [7]
Precipitation is your answer hope this helps pls thank me
3 0
3 years ago
Read 2 more answers
What is the study of life called
riadik2000 [5.3K]
Biology, bio=life, logy is study
7 0
3 years ago
Read 2 more answers
Given the sequence ATGGCGAATCACGTCACTTGA
Marina86 [1]

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

4 0
3 years ago
Other questions:
  • 1 2 3 4 5 6 7 8 9 10 TIME REMAINING 36:29 Recreational activities can cause an increase in erosion rates. Please select the best
    13·2 answers
  • Humans use blank for many different things in particular roofing and building materials
    6·1 answer
  • A student is investigating the role diffusion plays in maintaining homeostasis inside of animal cells. The student plans to plac
    9·2 answers
  • Number the following steps in the correct order and tell which stage it occurs in:
    7·1 answer
  • The Grand Canyon was carved out by the Colorado River. This caused the separation of members of a squirrel species. Abert’s Squi
    9·2 answers
  • Suppose an abundance of hunting decreases the number of foxes in the ecosystem. Which of the following is the most likely impact
    14·2 answers
  • Plzzz help meee I am timed
    14·2 answers
  • Can someone please help
    5·1 answer
  • In the free association technique of psychoanalysis, the______.
    5·1 answer
  • If a disease destroying barley plants in a field swept through an ecosystem, what would happen to the barley eating bird populat
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!