I am pretty sure it is CD4 cell
<u>Answer:</u>
<em>
heat is released by the combustion of 
of methane</em>
<u>Explanation:</u>
The value of enthalpy determines whether the reaction is exothermic or endothermic. If the enthalpy change is positive, then the reaction is endothermic (heat or energy released) and if the enthalpy change is negative then the reaction is exothermic (heat or energy absorbed).
![\Delta H \ reaction=[ 2(\Delta HfCO_2)+ 4(\Delta HfH_2O)]-[2(\Delta HfCH_4)+4(\Delta HfO_2)]](https://tex.z-dn.net/?f=%5CDelta%20H%20%5C%20reaction%3D%5B%202%28%5CDelta%20HfCO_2%29%2B%204%28%5CDelta%20HfH_2O%29%5D-%5B2%28%5CDelta%20HfCH_4%29%2B4%28%5CDelta%20HfO_2%29%5D)
=![2 ( -(393.5 KJ)/mol)-[2( -74.6 KJ/mol)+4(-241.82 KJ/mol)]](https://tex.z-dn.net/?f=2%20%28%20-%28393.5%20KJ%29%2Fmol%29-%5B2%28%20-74.6%20KJ%2Fmol%29%2B4%28-241.82%20KJ%2Fmol%29%5D)
![= -787 KJ/mol-[ -149.2 KJ/mol-967.28 KJ/mol]](https://tex.z-dn.net/?f=%3D%20-787%20KJ%2Fmol-%5B%20-149.2%20KJ%2Fmol-967.28%20KJ%2Fmol%5D)
<em>In this question, </em><em>the enthalpy of formation</em><em> has positive value and hence the </em><em>reaction is endothermic</em><em> in which the heat is released.
</em>
Plating is a producing procedure wherein a skinny layer of steel coats a substrate. this may be achieved via electroplating, which calls for an electric current, or via electroless plating, which is in the autocatalytic chemical method.
The two techniques have different effects. Coating involves the usage of paint, like a powder-lined end. The process of plating, mainly “electroplating,” includes passing cutting-edge through an electrolyte. It splits and deposits atoms on metallic objects, making them electroplated.
Like plating, the coating is applied to metallic surfaces for protective functions. however, unlike electroplated surfaces, powder-lined surfaces are basically blanketed in paint – not steel.
The plating procedure is a submit-manufacturing system. It involves the coating or overlaying of the surface of a workpiece with a skinny layer of metallic. The simple know-how of Plating to have a thin layer of one steel coating a substrate. therefore, the aim is to enhance the general quality of the product.
Learn more about Plating here:
brainly.com/question/24813726
#SPJ4
C. The Composition of your blood
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
