1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
8

Name 4 things that the skeletal does.

Biology
2 answers:
Orlov [11]3 years ago
8 0
<span>1. Movement 2. Flexibility 3. Protection 4. Support</span>
elena-14-01-66 [18.8K]3 years ago
6 0
The skeletal system performs vital functions-support, movement, protection, blood cell production, calcium storage and endocrine regulation-that enable us to survive.

Your Welcome!!!
You might be interested in
Meningo encephalitis is caused by​
DedPeter [7]

Meningitis is an inflammation of the membranes (meninges) surrounding your brain and spinal cord. ... Most cases of meningitis in the United States are caused by a viral infection, but bacterial, parasitic and fungal infections are other causes. Some cases of meningitis improve without treatment in a few weeks.

4 0
4 years ago
Read 2 more answers
Hi! I am confused on how to do Q2. Anyone doing A-levels can solve that questions and explain? Thanks! &lt;3
riadik2000 [5.3K]

Answer:

i) Glucose

ii) β(1-4) glycosidic bonds.

iii) Oxygen

Explanation:

Cellulose is an important structural carbohydrate found in plants. It forms a major component of the plant cell wall.

Cellulose is a polysaccharide formed by monomers of glucose.  These glucose monomers are joined together by covalent bonds called β(1-4) glycosidic bonds, which means that the 1st carbon of one glucose is bound to the 4th carbon of the next glucose. To make this arrangement,  every other glucose molecule in cellulose is inverted, which you can see in the diagram.

Glucose monomers contain carbon, hydrogen, and oxygen only. If you look at the pattern of the molecule (remembering every second glucose is inverted), you can see that Z must be O.

The functional group denoted by Z is oxygen. The OH groups on the glucose from one cellulose chain form hydrogen bonds with oxygen atoms on the same or on another chain, holding the chains firmly together and forming very strong molecules - giving cellulose its strength.

4 0
3 years ago
What plant pigments are involved in photosynthesis?
Mrac [35]
The plant pigments that are involved in photosynthesis are chlorophyll pigments, mostly chlorophyll A. They are found in chloroplasts.
7 0
3 years ago
Which of the following is a description of chyme?A. A watery mixture of partially digested food released by the stomach into the
Maurinko [17]

The correct answer is: A. A watery mixture of partially digested food released by the stomach into the intestines

Chyme or chymus is formed in the stomach, during the process of digestion (it takes 40 minutes to 3 hours to be produced) , and it is transported to the small intestine-duodenum.

In the beginning of the digestion (in the mouth), mixture of food and saliva called bolus, is formed. Mechanical and chemical breakdown of a bolus creates chime which is ready for the extraction of nutrients from it.

6 0
3 years ago
Compare and contrast transcription and translation
tangare [24]
So first transcription takes place which is a RNA that translates DNA Template. So an example would be DNA has AGCGTCAATCTA this will be translated into UCGCAGUUAGAU

Then this message is send off to become a protein with the MRNA which then comes Translation which is the process of converting UCGCAGUUAGAU into a protein and the way it’s done is by this message going through a ribosome and gets translated by TRNA that brings amino acids together to form codons and create your protein.
6 0
3 years ago
Other questions:
  • Suppose that a species of toads is introduced into a new environment in an attempt to reduce the populations of insects. The toa
    7·1 answer
  • Water is an example of a<br><br>A. mixture<br>B. non-polar molecule<br>C. solute<br>D. compound
    15·1 answer
  • When is observation a better tool for proving a hypothesis than experimentation
    12·1 answer
  • A geologist concludes that a rock sample is an extrusive igneous rock. Based on this information, which statement about the rock
    8·2 answers
  • The appendages of cockroaches and turtles are modified for creeping movements,but their internal structures are completely diffe
    14·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Single- celled organisms are able to maintain internal stability because they
    11·1 answer
  • One tool is big and oje tool is smarl sjaja7​
    13·1 answer
  • Njklhfdklofevkl;qemsakdlcxlsd vkjlmczx,ds cx
    5·1 answer
  • If you were designing a new insecticide absorbed via the respiratory system in arthropods, the killing chemical would enter the
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!