Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
Pituitary gland is known as the master gland
Answer:
Nitrogen is removed from the atmosphere mainly by nitrogen-fixing bacteria in the soil and oceans (blue-green algae).
Explanation:
Nitrogen is removed from the atmosphere mainly by nitrogen-fixing bacteria in the soil and oceans (blue-green algae).
Answer:Morphology and Physiology
Explanation:Morphology studies the form,structure and features of an organism this could include the shape,height,color etc while physiology help study the underlaying factor that gives rise to the ways its functions.
This two are key for a Biology to group an organism for when the morphology is know it is possible to classify such organism.
