1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinil7 [7]
3 years ago
8

What is the name for a place where a particular organism lives?

Biology
1 answer:
umka21 [38]3 years ago
4 0

Trees, bushes, moss and grass live in a forest habitat.

You might be interested in
In dogs, colored fur, e, is dominant over colorless fur,
Amanda [17]
It would be 50%. Because the father was brown EeBb x eebb results in 25%. black, 25%. Brown 25%, and yellow 25%.
6 0
3 years ago
Researchers noted that when a lysine residue on a histone is acetylated, its side chain becomes neutral in charge. Combined with
lesantik [10]

Answer:

The correct answer is A) Histone deacetylation generally decreases gene expression.

Explanation:

Histones are the proteins that are responsible for the condensation of chromatin, which is directly linked to the capacity that a gene has to be expressed. The more condensed a gene is, the less expressible it becomes.

In order to regulate the gene expression, histones can suffer from many modifications that can change their conformation and the expressiveness of specific genes.

<u>Histone acetylation is linked with an increase of gene expression; while deacetylation and methylation decrease gene expression.</u>

3 0
3 years ago
Considering only the unlinked gene loci a and b, how many different kinds of gametes can an individual with genotype aabb produc
Helga [31]

Only one kind of gamete(ab)

5 0
3 years ago
____ is a single layer of cuboidal cells located along the base of the epidermis. These cells regularly divide by mitosis to rep
Andre45 [30]

Answer:

The basal cell layer (stratum basale, or stratum germinosum), is a single layer of cells, closest to the dermis. It is usually only in this layer that cells divide.


In the skin on the sole, the stratum corneum is very thick. A single layer of cuboidal cells located along the base of the epidermis. ..

5 0
1 year ago
Although allergic reactions are triggered by allergens like pollen and fungi, the actual cause of the symptoms like mucous produ
choli [55]
Histamine.  Your body produces this, which activates allergy symptoms.  Please mark Brainliest!!!
4 0
3 years ago
Read 2 more answers
Other questions:
  • How do bicarbonates influence biotic factors
    13·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Nstead of clear-cutting land and moving on, a local lumber business decides to start farming trees: cutting some of the trees an
    13·1 answer
  • Which of these is an advantage of using models to study tectonic plate movements?
    14·2 answers
  • Why are Red pandas going endangered?
    12·2 answers
  • The diagram shows a type of lipid.
    13·2 answers
  • How the plantlets are produced?​
    12·1 answer
  • why do prevailing winds and positions of islands cause warm ocean currents to pass Christchurch in normal years
    12·1 answer
  • A train moving at speed of 50km/h. How many hours will it take the train to travel 600km
    8·2 answers
  • Neurotransmitters can __________________ receptors to turn them on or __________________ them to stop them from transmitting.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!