1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kati45 [8]
3 years ago
6

What goes into 26.1 and 3.6

Mathematics
1 answer:
chubhunter [2.5K]3 years ago
4 0
3.6 goes into both of them. Hope this helps
You might be interested in
-9 is greater than<br> a. -10<br> b. -7 <br> c. -6 <br> d. -9<br> e. 0
Alex_Xolod [135]

Answer:

-10

Step-by-step explanation:

On the number line -9 appear before -10. Thw futher the number, the smaller it gets

4 0
3 years ago
What is the least positive integer?
k0ka [10]
-1? I'm guessing the least
3 0
3 years ago
Select True or False for each statement.
Margarita [4]
The first statement and the second statement are FALSE.

In mathematics, a function<span> is a relation between a set of inputs and a set of permissible outputs with the property that each input is related to exactly one output. An example is the </span>function<span> that relates each real number x to its square x</span>2<span>.
</span>
I hope my answer has come to your help. God bless you and have a nice day ahead!
7 0
3 years ago
If gh-f=g-h, which of the following gives g in terms of the other variables?
JulsSmile [24]

The value of g in terms of other variables is g=\frac{f+h}{h-1}

Given the expression;

gh-f=g-h

We are to express g in terms of other variables as shown;

gh-f=g-h

Collect the like terms

gh - g = f + h

Factor out g

g(h - 1) = f + h

Divide both sides by h-1

g=\frac{f+h}{h-1}

Hence the value of g in terms of other variables is g=\frac{f+h}{h-1}

Learn more here: brainly.com/question/21406377

5 0
2 years ago
20% of a number is xx. What is 100% of the number? .
ludmilkaskok [199]
So you said 20% is xx???
If 20% is xx or x^2 (x squared) then 100% must be 5x^2, since 20% times 5 would get you 100%.
5 0
3 years ago
Other questions:
  • An artists builds a sculpture out of metal and wood that weighs 14.9 kilograms.3/4 of this weight is metal,and the rest is wood.
    5·2 answers
  • I need help. what's the answer and what do the exclamation points mean.
    11·1 answer
  • How to do fraction ?
    5·2 answers
  • What is 9/31 simplified?
    13·2 answers
  • Emeline can type at a constant rate of 1/4 mpages/minute. How many pages can she type in 1 hour (60 minutes)?
    6·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Help ASAP!!! Easy question i guess?
    8·2 answers
  • 0.66x10 to the 3rd power
    6·2 answers
  • Four eggs can be bought for $.10 how many eggs can be bought for $.30
    13·2 answers
  • Batman slings a 320 ft. climbing cable from a helicopter to his batmobile below. If the cable tightens up
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!