5 chromosomes. Meiosis results in 4 haploid cells, meaning they have "n" pairs of chromosomes. The diploid cell that the 10 chromosomes originated in has "2n" pairs. This leaves us with a simple equation to solve the problem, 2n=10, so n must equal 5 chromosomes.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer: B) II, IV, V
Explanation:
II, IV, V Sexual reproduction involves both parents. Chromosomes are passed to offspring in sex cells, egg and sperm. Offspring are not identical to either parent.
