1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paul [167]
3 years ago
7

The nearest star to the earth is the____ A Milky Way B sun C orion

Biology
2 answers:
Aleksandr [31]3 years ago
6 0

sun

are you having a stroke

the milkyway is an entire galaxy

orion is a mythical shape we made in the sky

erma4kov [3.2K]3 years ago
5 0

Answer: Answer: The Sun

Explanation:

You might be interested in
Which of the following statements is/are true of corals?
iogann1982 [59]

Answer:

The correct answers are option A. "Corals are animals".  B. "Corals are benthic organisms"., and E. "Corals live in tropical water".

Explanation:

Corals are animals, what we know as a coral, is in fact a group of small animals called polyps that need food to survive. Corals are benthic organisms because they live at the bottom of the sea. The subclass of benthic organisms that corals belong is called Macrobenthos, for being large enough to be seen at the naked eye. Corals live mostly in tropical waters, because they do not tolerate waters with a temperature below 18 Celsius.

7 0
3 years ago
Read 2 more answers
Spontaneous reactions _____. always result in increased disorder of the system always take place at a rapid rate always release
Dmitry_Shevchenko [17]
The correct answer is that it "naturally favor the formation of products".
Spontaneous Reactions is best described as a response that favors the formation of merchandise on the situations under which the reaction is happening. A roaring bonfire is an instance of a spontaneous reaction, for the reason that it is considered to be exothermic (there may be a decrease in the energy of the system as strength is launched to the environment as warmness).
6 0
4 years ago
11. One function of __________________________ is the digestion, or breakdown, of lipids, carbohydrates, and proteins into _____
Rzqust [24]

Answer:

lysosomes, small molecules

Explanation:

-plants:usually not evident Animals: occurs in cytoplasm

-small organelles filled with enzymes

-"clean up crew"

- the digestion or breakdown of lipids, carbs, and small proteins into small molecules that can be used by the rest of the cell

-involved in breaking down organelles that have outliveed their usefullness

-diseases are trace to lysosomes that dont function properly

3 0
3 years ago
How does wind cause erosion​
Aleksandr-060686 [28]
<h3>I think it's helpful for you ✌️✌️✌️✌️✌️✌️❤️</h3>

5 0
3 years ago
True or False: Blood is essential to homeostasis. *<br><br> True<br> False
asambeis [7]

Answer:

True

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the energy of the hydrogen ion gradient created across the inner mitochondrial membrane used to make?
    11·2 answers
  • Where do producers get their energy?
    14·2 answers
  • Why do you suspect that there are so many plasmodesmata connecting the cells in this fruit?
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following is a scientific question about lavender plants?
    12·2 answers
  • Why is a rain drop a particularly damaging element to soil?
    5·2 answers
  • A dehydrated seagull has a choice between a sea turtle, a shark, and an octopus that have washed up on the beach to make a meal
    15·1 answer
  • BRAINLIESTTT ASAP!!
    12·1 answer
  • The liver cells of cats contain 48 chromosomes. After meiosis is complete, how many chromosomes are in the new daughter cells?
    13·1 answer
  • Why can proteins act as excellent catalysts of chemical reactions in the body?.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!