1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PolarNik [594]
3 years ago
10

Plant cells can better tolerate exposure to hypotonic solutions than can animal cells. Which one of the following helps to best

explain why plant cells can better tolerate hypotonic solutions? a. The hot sun on plant cells causes any extra water to evaporate. b. The rigid cell walls limit how far plant cells can expand and exert a back pressure to limit further water uptake. c. Chloroplasts consume the extra water in photosynthesis, decreasing the swelling. d. The veins in plants drain away the extra water from the plant cells. e. Stomata in plant cell leaves quickly drain excess water from the cells.
Biology
1 answer:
anzhelika [568]3 years ago
5 0

Answer:

b. The rigid cell walls limit how far plant cells can expand and exert a back pressure to limit further water uptake.

Explanation:

Plant cells have a rigid cell wall made of cellulose. Animal cells lack a cell wall.  

When the plant cells are placed in a hypotonic solution, water enters into the cells and the cells expand. However, after a certain limit, the cell wall exerts wall pressure on the contents of the cell and does not allow it to take more water in. The wall pressure from the cell wall of plant cells protects them against bursting when placed in a hypotonic solution.

Animal cells burst out due to intake of water by osmosis when placed in a hypotonic solution. They do not have a cell wall to protect them from bursting.  

You might be interested in
What is the term expressing how a receptor can be stimulated by a certain stimulus but not any other stimuli?
Sveta_85 [38]

Receptor specificity Physical energy such as light, sound, and heat is detected by specialized receptor cells in the sense organs—eyes, ears, skin, nose, and tongue. When the action potential that relays information about the stimulus through the nervous system to the brain. Sensory receptors take in information from the environment, creating local electrical currents; These currents are graded. 

6 0
3 years ago
Diagram about plant cells and animal cells to identify their part​
julsineya [31]

Answer:

Plant and animal cells are the same. Besides a few parts

Explanation:

Plants have cell walls and chloroplasts

Hope this helps!

4 0
3 years ago
An acid is best defined as: Select one:
AveGali [126]

Answer:

A.) a substance with ph between 0 and 7.

Explanation:

as acid has pH value between 0 to 7.

6 0
3 years ago
Read 2 more answers
Diagram of gastrulation and neurulation?
kozerog [31]
Following gastrulation, the next major development in the embryo is neurulation, which occurs during weeks three and four after fertilization. This is a process in which the embryo develops structures that will eventually become the nervous system
8 0
3 years ago
I need some help with an environmental science question.
Tanya [424]
Nematodes<span> are the bacterial feeders, fungal-feeders, plant parasites, predators, and omnivores.</span>
7 0
3 years ago
Other questions:
  • Which process is a "build up" process? ______________________________________ which process is a "break down" process? _________
    5·1 answer
  • The code name used by journalists Carl Bernstein and Bob Woodward for the high-ranking government official who helped them uncov
    8·1 answer
  • Explain the effects of unregulated (or abnormal) cellular processes on the body
    13·1 answer
  • The nurse is assisting the physician with a procedure to remove ascitic fluid from a client with cirrhosis. what procedure does
    6·1 answer
  • What is the genus and species of the animal that has retractable claws and is domesticated?
    5·2 answers
  • Research suggests that high dietary intake of ________ by pregnant women may be related to higher iq levels among children.
    7·1 answer
  • I need help , check the highlighted words , thank you ✌.
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Second page <br> only one person understand
    5·1 answer
  • What hormone lowers your blood glucose levels? Where does the excess glucose go?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!