Power is measure in watts which is joules per second
Answer:
All of the above
Explanation:
U 2 can help me by marking as brainliest.......
Answer:
There are two possible answers: Deep-sea vents provided the energy needed for the first organic compounds to form OR self-replicating RNA molecules passed on genetic information.
Explanation:
The reason for the first answer is due to the hypothesis that indicates that life (organic molecules) arose from inorganic molecules synthesized from the amino acids in those energy vents. This is called the metabolism first hypothesis. The Miller-Urey Experiment provided evidence that organisms could rise from inorganic molecules (they simulated under the conditions you would see on early Earth). The second hypothesis is the RNA World hypothesis (second answer) which suggests that the formation of RNA that could replicate (possible due to mutation or evolution), led to life that could preserve its genetic integrity through replication (greater stability to the organism) and create lipid bi-layer membranes/other organelles. Some scientists support the Metabolism First Hypothesis, while others are skeptical (this goes for the RNA World Hypothesis as well). However, the RNA World Hypothesis is for more reasonable in the fact that its main point is the fact that RNA molecules were able to replicate and maintain genetic stability despite early Earth conditions. Although either hypothesis could explain why all organisms share the same genetic code, the RNA World Hypothesis better explains the universality of DNA/RNA of genes that we see today.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein