1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sveta_85 [38]
3 years ago
13

PLZ HELP, WILL MARK BRAINLIEST

Biology
2 answers:
vazorg [7]3 years ago
8 0

1. Cell Wall

2. Mitochondria

Hope this helps! :)

Sonja [21]3 years ago
5 0
Your first answer is cell wall and your second is mitochondria I believe
You might be interested in
Which line serves as the boundary line between one day and the next?
Klio2033 [76]
Is there any multiple choice answers <span />
3 0
3 years ago
Which of the following best describes geothermal energy
daser333 [38]

A lava fountain is an example of the amount of heat stored in the Earth. Geysers, lava mountains and hot springs are all natural examples of geothermal energy.

5 0
3 years ago
The nurse is caring for an infant undergoing laser therapy for port-wine stain. which instruction does the nurse give to the inf
Ilia_Sergeevich [38]

The nurse can give the following instructions:

1. the procedure will most likely last for ten minutes

2. since it is still an infant, the child will be put under anaesthesia

3. a pulsed dye laser treatment will be given

4. if general anaesthesia will be given, then there are special rules for eating and drinking restrictions before procedure

<span> </span>

7 0
3 years ago
Select all that apply. Meiosis _____. maintains chromosome number throughout generations causes genetic recombination is employe
atroni [7]



Meiosis is the process of cell division by which involving gametes. Cell division is just the same for sperm and egg cells, but they have distinguishable descriptions and labels in the process. Spermatogenesis is for the males’ sperm cells and oogenesis is the process for females’ egg cells. The cell division of meiosis involves the two phases, respectively meiosis I and meiosis II. Meiosis I like mitosis is the cell division that produces diploid cells<span>. These diploid cells are cells that contain a complete pair of chromosomes which is 46. The result is two diploid cells after the first meiosis. To provide clear explanation, in contrast haploid cells only contain 23 chromosomes and are created after meiosis II which is 4 in number. </span>
6 0
3 years ago
Read 2 more answers
When a free-moving object moves from the North Pole (90%) towards the equator (0°), it curves fro
svetoff [14.1K]

Answer:

(3)

Explanation:

I found it on a website.

3 0
2 years ago
Other questions:
  • 1. This region is totipotent, which means its cells can continuously divide and grow.
    9·1 answer
  • Simon is studying a marsh ecosystem that is being altered by purple loosestrife, an invasive species, Simon
    13·1 answer
  • Which electron carrier is generated in the reaction catalyzed by malic enzyme?
    14·1 answer
  • The type of rock that has formed from seedements is called
    14·1 answer
  • Define 'ecosystem'. <br>with explanation<br>★★★★★​
    14·1 answer
  • What impact does reforestation have on the environment?
    12·2 answers
  • What is cellular respiration
    11·1 answer
  • Why silkworm is called queen of fibre?​
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Chemical compounds....... please help . it's due in 2 hours ​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!