1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
3 years ago
9

You are running an experiment on photosynthesis rates using the aquatic plant Elodea. Predict how the number of oxygen bubbles w

ill change with different distance from the light source.

Biology
2 answers:
brilliants [131]3 years ago
8 0

Answer:

D. Production of oxygen bubbles will increase as distance of plants from the light source decrease

Sergeeva-Olga [200]3 years ago
4 0

Answer:

I would say A. Production of oxygen bubbles will not change based on distance of plants from the light source.

Explanation:

This is because distance from the light source doesn't really matter in terms of the rate of photosynthesis. The role of light in photosynthesis is simply to provide the electrons necessary to kick of photosystem I in the light-dependent reactions. Whether far or close, the electrons will be supplied (think about the Sun). :)

You might be interested in
Which three planets shown have less gravitational pull than earth
yarga [219]
<span>Mercury, Venus, and Mars. It depends a bit on where you measure the gravity. </span><span>
</span>
7 0
4 years ago
WILL GIVE BRAINLIEST!!!!!!
Inessa05 [86]
Answer would be D!
Mark brainliest
5 0
3 years ago
Are triglycerides dengerous
Hatshy [7]

They are not something that you prevent from being made in your body. They are automatically made when you eat food that is not automatically converted into calories. This is used for energy later on for you body.

But too much of triglycerides is bad for you. This condition is called hypertriglyceridemia. Your doctor can detect if you have this condition by simply running a lipid panel (a blood test) that measures your overall cholesterol, you LDL and HDL cholesterol, and also measuring your triglycerides.

If you do take this test, they will make you fast for about 8 hours. They make you do this because triglycerides are usually lowest after you fast but goes up really high after a big meal (like a Thanksgiving Dinner!).

(Extra: your triglycerides are measured in milligrams per deciliter (mg/dL) and if your levels are:

BELOW 150 -----------------Healthy

150-199 -----------------------Borderline

200-499 ---------------------High

500+ --------------------------Very High


Most people are under 200, so in the end, you don't have to worry about your triglyceride levels.

You can read more about it here: https://www.cardiosmart.org/Heart-Conditions/High-Cholesterol/High-Cholesterol-Home/Very-High-Triglycerides


5 0
3 years ago
Write a short note on atp
Inga [223]
ATP stand for adenosine triphosphate. It consists of the nitrogenous base adenine and is linked to a sugar molecule. It is necessary for human life because it gives the body energy
7 0
3 years ago
Read 2 more answers
Which diseases result from inherited changes in DNA sequence?
anyanavicka [17]

Which diseases result from inherited changes in DNA sequence?

Mutations

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How do living things alter the biotic and abiotic environment to cause the process of succession?
    5·1 answer
  • Why does a proteins 3D structure determine its biological function?
    7·2 answers
  • The two cells formed by cell division are about ____ the size of the parent cell
    12·2 answers
  • What products of photosynthesis are the reactants of cell respriration?
    6·1 answer
  • SOMEONE HELP IM FAILING BIO
    6·1 answer
  • A good night's sleep improves recall of the previous day's events by facilitating the transfer of memories from the
    14·1 answer
  • Suggest how a cell may vary the rate of an enzyme controlled reaction:<br> nt
    14·1 answer
  • MAJOR BIO HELP PLEASE
    8·2 answers
  • In which structure in the ovary does an egg mature?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!