1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alekssandra [29.7K]
3 years ago
5

Aerobic respiration produces _______ as products.

Biology
1 answer:
dimaraw [331]3 years ago
8 0

Answer: carbon dioxide, water, and energy

Explanation: Aerobic respiration is a type of respiration that takes place in the presence of oxygen. In the presence of oxygen, a molecule of glucose is broken down in the cell to produce carbon dioxide and water with the release of energy. The energy released is in form of ATP. The equation for cellular respiration is C6H12O6 + 6O2 --> 6CO2 + 6H2O + Energy. The energy released in cellular respiration is used by the cells to drive other cellular processes.

You might be interested in
When sodium enters the neuron via chemically gated sodium channels, the membrane will depolarize. therefore, the membrane potent
Korvikt [17]
........... the membrane potential will become more POSITIVE.
A membrane become depolarize when sodium enters the neuron via chemically gated sodium channels, this means that, the membrane become more positive when sodium ions diffuse into the cells.<span />
8 0
3 years ago
The collar cells of sponges are similar to _____.
grin007 [14]
<span>B. Flagellated protists. hope I helped give me brainiest please.</span>
6 0
3 years ago
In drosophila melanogaster, the common fruit fly, curved wings "I" and purple eyes "r" are two linked recessive genes found on c
Harlamova29_29 [7]

Answer:

40 \times 60 \\  = 240

<h3><u>2</u><u>4</u><u>0</u><u> </u><u>is</u> the answer</h3>
7 0
2 years ago
Read 2 more answers
What is a planned goal of the psyche mission
CaHeK987 [17]

Answer:

The planned goal of psyche mission is the increase in the knowledge and understanding of planetary information and interiors.

Explanation:

The psyche mission<em> is an orbiter mission of exploring the origin of planetary chores through the study of metallic asteroids.</em>

As of any mission, it has to have a reason for exploration.

The psyche mission therefore has a reason which are its goals.

Among the goals are:

  • Understanding previously unexplored earth's building blocks.
  • Explore a new world made up of metal
  • Examine the interior of a different world to aid examination of terrestrial planets.

8 0
3 years ago
Read 2 more answers
After this, rRNA creates bonds between _____________ to make __________
Nezavi [6.7K]

Answer:

After this, rRNA creates bonds between <u>amino acids</u> to make <u>proteins.</u>

<u>Some important points to know:</u>

rRNA (Ribosomal RNA) is used in the synthesis of proteins.

Amino acids are the building blocks of proteins which means that proteins are made up of amino acids.

When amino acids are joined together, they form proteins.

The bond between two or more amino acids when bonded is called "peptide bond".

\rule[225]{225}{2}

Hope this helped!

<h3>~AH1807</h3>
4 0
2 years ago
Read 2 more answers
Other questions:
  • Which elevation zone on the image above is best suited for growing bananas and sugarcane?
    5·2 answers
  • Which describes sand?
    6·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Paralysis is a term used to describe the loss of muscle function. if tetrodotoxin's effect is on neurons, why did dr. westwood e
    15·1 answer
  • How might a decrease in biodiversity affect medical discoveries and treatments?
    6·1 answer
  • Describe how enzymes affect chemical reactions and explain why this makes enzymes important to living thing.
    11·2 answers
  • what do some of your cells do to keep facilitated diffussion operating while transferring glucose into the cell?
    15·2 answers
  • What is the difference between a missense mutation and a silent mutation..
    9·1 answer
  • A) How many children does the couple have?
    10·1 answer
  • What is Random error in science ?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!