1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrej [43]
3 years ago
6

What is the definition of an adaptive feature and why is it important? (try to use the word 'fitness' in your answer.)

Biology
1 answer:
Tresset [83]3 years ago
5 0
An adaptive feature is some something that the character can develop in its lifetime, an example can be the adaptive feature of fitness. the characters has started to go to the gym four times a week this past month.
You might be interested in
Artifacts have __________ value.
Elis [28]

Answer:

espoused values

Explanation:

plz brainliest

5 0
3 years ago
Advantages of written communication​
Pachacha [2.7K]

Answer:

Advantages of written communication: Easy to preserve: The documents of written communication are easy to preserve. Oral and non-verbal communication cannot be preserved. If it is needed, important information can be collected from the preserved documents.

6 0
3 years ago
Meteorologists take careful measurements of daily minimum temperatures, maximum temperatures, and precipitation (rainfall). The
Vinil7 [7]

Months with higher temperature have more rainfall.

Explanation:

From the presented graph, we can see that all three parameters are following a same trend. When the maximum temperatures increase, the minimum temperatures increase too, and the rainfall increases as well. When the maximum temperatures decrease, the minimum temperatures decrease, and the rainfall decreases too.

There is a simple explanation for the connection of higher temperature and more rainfall in Scotland. Scotland is located on an island, thus it is heavily influenced by the sea. When the temperature is higher, the humidity is higher, and in accordance to that more rainfall occurs. When the temperature is lower, the humidity is lower, so there is less rainfall, or instead of rainfall the precipitation can be manifested as snowfall.

7 0
3 years ago
Earthquakes produece two types of waves that flow through the interior of earth
Gwar [14]

earthquakes produce both body and surface waves which is the fast sesmic wave!!

hope this helps!!

5 0
3 years ago
**Easy**quick**extra points**
12345 [234]

Answer:

A Trust me I'm a genius

Explanation:

I pretty sure it would only make sense to me

6 0
3 years ago
Read 2 more answers
Other questions:
  • A growth composed of more than one kind of neoplastic tissue is called a
    8·1 answer
  • Which type of rock is formed from cooling molten rock?
    5·2 answers
  • What allowed the sumerians to pursue activities other than finding food?
    6·1 answer
  • Abnormal cells crowd out what kind of cells and steal nutrients
    11·1 answer
  • What early scientist published the Principles of Geology, published in 1830?
    6·1 answer
  • What do the lichens and mosses produce to break down rocks to begin the formation of soil?
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What are the nitrogen bases found in DNA? Explain
    12·1 answer
  • What is modern genetic techniques?
    11·1 answer
  • Stage in meiosis where the cytokinesis follows and two daughter cells are formed. Each cell now has half the chromosome number b
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!