1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill [66]
2 years ago
12

What basic organizational principle is true of the ECM of animal cells compared with plant cell walls

Biology
1 answer:
MakcuM [25]2 years ago
8 0

Explanation:

In order to form tissues, individual cells must bind and communicate with each other. Extracellular material surrounds cells to provide cohesion and structure. This structural component is known as the extracellular matrix (ECM) for animal cells and the cell wall for plant cells. Although they are made up of different components, both the ECM and cell wall have similar structures. Both consist of structural fibers, a hydrated matrix, and adhesive molecules.

You might be interested in
What do you know about the Punnett Square? (Don’t research it or you will not get credit for this question.)
Ivanshal [37]

Answer:

Well it says not to research so here's a brief definition: A punnet square is a diagram that shows the genotypes of a cross and helps predict the probability of having certain genotypes.

Explanation:

Heres some words to know

-Dominant

-Recessive

-Allele

-Mendel's law of Heredity

Let me know if you want more explanation on these :)  

8 0
3 years ago
Read 2 more answers
Water molecules stick other molecules. this property is called?
liraira [26]
The property called cohesion
8 0
3 years ago
20. Which nutritional classification would you predict to fit most of the well-known members of the human microbiome? A. Photoli
DaniilM [7]

Answer:

b

Explanation:

5 0
3 years ago
Newborn infants were given either smooth or knobby pacifiers to suck. They were later allowed to look at both types of pacifiers
tia_tia [17]

Answer:

<em><u>intermodal perception 10000% SURE</u></em>

hope i helped

-lvr

5 0
3 years ago
Using Figure 2, who is the father of the offspring? *<br><br> Male 1<br> Male 2<br> Male 3
Ray Of Light [21]
Answer: Male 3
You can see which ones match up.
Hope this helped! :))
4 0
3 years ago
Other questions:
  • Mr. Cortez had a good conversation about the fairness of restitution and retribution with 9-year-old Sherrod. The next day, Sher
    8·1 answer
  • Acupuncture is an alternative medicine that uses wire-thin needles inserted by a trained practitioner into specific points in th
    15·2 answers
  • Hi what is a type of poisonous frog name
    6·2 answers
  • Animals that have gills when found and lungs as adults?
    5·1 answer
  • What are chromosomes?​
    14·2 answers
  • Which type of rock does magma form when it hardens?
    7·1 answer
  • Are Moon craters the result of volcanoes or impacts?
    11·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Can someone plz help. Is it A,B,C,D make sure it’s correct
    13·1 answer
  • The illustrations are models of cells and cell organelles.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!