3 years ago

What is the behavior of homologous chromosomes during prophase?

1 answer:

5 0

Comparison of meiosis and mitotic cell division. As in the previous figure, only one pair of homologous chromosomes is shown. In meiosis, after DNA replication, two nuclear (and cell) divisions are required to produce the haploid gametes.

You might be interested in

Please I need help with this

barxatty [35]

TAAGCCGATAAATGCTAACGGTA

6 0

2 years ago

Read the statements about scientific theories below, and determine if they are true or false. A theory is a hypothesis that is s

Ann [662]

Answer: true, false, true, true

6 0

3 years ago

Based on fossil evidence about how long ago did the first single-cella’s life from appear on earth

Iteru [2.4K]

Answer:slat

Explanation:

Slat rat

6 0

2 years ago

Read 2 more answers

The diagram illustrates one method of genetic recombination which method of genetic recombination is illustrated in the diagram

photoshop1234 [79]

<span>independent assortment Good Luck</span>

4 0

3 years ago

Molecules that cut dna at specific sequences are known as

Neko [114]

Answer:

Restriction enzyme, also called restriction endonuclease, a protein produced by bacteria that cleaves DNA at specific sites along the molecule

Explanation:

Hope it helps

3 0

3 years ago