1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mamaluj [8]
3 years ago
7

In a relatively small iguana population the allelic frequency is tracked for three generations. Webbing is a recessive allele; n

o webbing is the dominant allele. During one very rainy spring and summer, a flood washes all the iguana without webbed feet out to sea. By the fall, and three generations later, you have the gene pool seen here. This is an example of A) gene flow. B) immigration. C) genetic drift. D) founder effect.
Biology
2 answers:
zloy xaker [14]3 years ago
8 0

Answer:

C) genetic drift.

Explanation:

In this question, the alleles of the dominant trait that is without webbed feet are eliminated from the population due to flood in the area where the iguana population was living.

This elimination of the dominant alleles due to flood is a by chance event or a random event. This event changed the gene pool of the population and the population with left or recessive alleles will survive.

This change in the gene pool of a small population due to the random effect is known as the genetic drift.

Thus, Option-C is the correct answer.

arsen [322]3 years ago
4 0

Answer:

The answer is C

Explanation: The random change in the gene pool is due to genetic drift. Remember, genetic drift occurs at a more rapid rate when the population size is reduced. The flood is a random occurrence. It could have as easily been a drought.

You might be interested in
The primary producers in an ocean grazing food web are usually ________.
Butoxors [25]

Answer:

phytoplankton

Explanation:

Phytoplankton can be defined as a set of photosynthesizing microorganisms that live floating on the water surface. It is composed of microscopic algae and cyanobacteria, which can be unicellular, colonial or filamentous. These microorganisms are defined as the primary producers of an ocean grazing food network.

Because phytoplankton live in aquatic environments - both in limic (eg lakes) and marine environments - they have a number of adaptations that guarantee their survival in the water column.  Some of these microorganisms, for example, have flagella that aid locomotion; others, in turn, have gas vacuoles that aid in flotation, while some of them have mucilage, which surrounds the cells and ensures protection, flotation and locomotion.

4 0
2 years ago
Weather changes ____ , while climate changes ____.
oksian1 [2.3K]
Weather changes every day, while climate changes annually or every 3 months
7 0
3 years ago
Read 2 more answers
All individuals have two alleles for a given trait. According to Mendel's ____________, these alleles are passed down one each f
nata0808 [166]
The correct answer for this question is A. Law of segregation.

All individuals have two alleles for a  given trait. According to Mendel's Law of segregation, these alleles are passed down one each from both mother and father.  

Explanations;
According to this law of segregation the allele pairs separate or segregate during the formation of gamete, during the process of meiosis, leaving each cell with a single allele for each trait, and randomly unite during fertilization. One pair of allele comes from the mother while the other pair comes from the father, and joins together to form a diploid cell. Therefore, organisms inherit two alleles for each trait one from each parent. 
5 0
3 years ago
Which accurately describes gymnosperms? Check all that apply. Some of them lose their leaves in winter.Some of them lack seeds.S
AleksandrR [38]
I think that correct answers are:
<span>Some of them lose their leaves in winter. (i.e. <span><em>Larix</em></span>)</span>
<span>They include the tallest plants (i.e<em>.Sequoia)

</em>I don't think they are the oldest type of seed plants, since in the past the classes like progymnosperms and seed ferns existed prior to the gymnosperms. But question isn't absolutely clear to me and I can't be 100% sure.
All of the gymnosperms have seeds unless human grows some seedless variant.
Gymnosperms don't have flowers like angiosperms do, but some people think that cone is kind of flower.
Male cones produce pollen, not female.
Hope I helped :)
<em /></span>
7 0
2 years ago
Read 2 more answers
How do they use bias to sell their products? How would you use skepticism to evaluate the data that these companies use in their
Fittoniya [83]
 They use cognitive biases like framing, loss aversion, status quo etc. to elicit an emotional response in hopes of you making impulsive purchases.

You can use skepticism by listening more carefully to what is being said and looking up any claims made by the advertiser. Like if they say they are the cheapest car insurance, you don't just believe them you compare prices.

7 0
2 years ago
Other questions:
  • Mineral crystals are characterized by having _______ and _________ surfaces.
    12·1 answer
  • Lichens help with soil formation because they
    6·2 answers
  • . The Vmax of a glucose transport into a certain preparation of red blood cells is determined to be 1206nmol glucose/s without A
    5·1 answer
  • TAC CCC TAA GTG GGC GAT ATT what is the RNA
    11·1 answer
  • 17. When a predator is out-competed for biotic resources (prey) by other beller-
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The __________ are primarily responsible for maintaining the salinity of the renal medulla versus the renal cortex.
    13·1 answer
  • 3. MS-ESS2-5. What usually happens when a cold front and a warm front collide? Tornadoes Rain High Wind all of the above​
    5·1 answer
  • Need help ASAP! THANK YOU BOYS AND GIRLS
    5·1 answer
  • What is this? Please answer with an explanation
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!