1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolbaska11 [484]
4 years ago
11

A client is admitted to the coronary care unit with atrial fibrillation and a rapid ventricular response. the nurse prepares for

cardioversion. what nursing action is essential to prevent the potential danger of inducing ventricular fibrillation during cardioversion?
Biology
1 answer:
finlep [7]4 years ago
8 0
Synchroniser switch is in the "on" position.
You might be interested in
What does DNA replication mean?​<br><br>thankyou ~
Anestetic [448]
DNA replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. ... An enzyme called DNA polymerase next begins replicating the DNA by matching bases to the original strand.

(Mark as brainliest if you can please if not that is okay )
3 0
2 years ago
Read 2 more answers
Do you think that sharks and dolphins' similarities (body shape, fin, and flippers) are homologies or analogies
lions [1.4K]

Answer:

homologous* or analogous*. You spelled them wrong :)

I believe they are homologous because they more than likely share ancestry. They are underwater animals with the same... everything pretty much.

Explanation:

8 0
3 years ago
Is the pit that marks where the umbilical cord was attached before birth?
liubo4ka [24]
The pit that marks the location of the umbilical cord after birth is known as the navel or belly button. All animals that grow placenta during fetal development will have a navel or belly button. The scientific name of the structure is the umbillicus. It can be a depression in some individuals or raised in others.
5 0
3 years ago
1) How do greenhouse gases help maintain a mean global temperature?<br> I
alexdok [17]

Answer:

the heat

Explanation:

the greenhouse effects holds the heat inside the house therefore turnis into eveporation and than water droplets that the plants take in.

6 0
3 years ago
Read 2 more answers
We are doing this in science and I don’t know how to do it
uysha [10]

Answer: The equation you are going to use is D=M/V. Plug the density number in that the question provided and do the same for volume and solve for m.

Explanation:

11.3=m/6.7

11.3x6.7=m

5 0
3 years ago
Other questions:
  • How can a predator help drive the natural selection process of a prey species?
    9·2 answers
  • In an experiment, the solubilities of carbon dioxide and oxygen gases are studied over a temperature range from 0°C to 60°C. Ide
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Having an insufficient daily diet is called __________. A. agriculture B. supply and demand C. production D. malnourishment Plea
    8·1 answer
  • Help me please,Thanks
    13·1 answer
  • Which two pieces of fossil evidence support the idea of continental drift?
    10·1 answer
  • Biologists are fairly certain that oxygen was built up in the atmosphere by the development of photosynthesis. The production of
    13·2 answers
  • brain-powered cars may most likely reduce ____caused by distracted drivers. a. fuel consumption b. traffic accidents c. harmful
    14·2 answers
  • Why is genetic variation important
    8·1 answer
  • Which part of the cell membrane prevents the cell from dissolving in water?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!