1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viva [34]
3 years ago
7

.................................................

Biology
1 answer:
valentina_108 [34]3 years ago
5 0
The fox or wolf thing and the hawk 
You might be interested in
White a paragraph comparing the organices in a to the organs in your body.
Vlada [557]

Answer:

An organ is a part of the body of a living organism perform a specific role in the body such as the stomach, the liver and many more. Organelles on other hand are like organs of the cells that are contained in the cytoplasm of cell these also have a certain specialized roles to play for the cell, and they all depend on each other. The example of the organelles are nucleus, mitochondria and many more.

* Organelles are structures inside the cytoplasm of cells

* Organs are amde up of tissues composed of group of specialized cells that, has a particular role in the body

8 0
3 years ago
What kind(s) of cells can develop from multipotent stem cells?
Yuri [45]
Any cells of the human body, except the cells of a placenta.
4 0
3 years ago
RNA A long, collection of genes that carries heredity information and is formed from condensed chromatin.
Kay [80]

The answer is Chromosome


A chromosome is a Deoxyribonucleic acid molecule with part or all of the genetic material of an organism.


- R3KTFORGOOD ☕

4 0
3 years ago
Read 2 more answers
A meter contains __________ centimeters
bearhunter [10]
100 centimeters make up one meter
7 0
4 years ago
Read 2 more answers
Which are best to survive?<br> The fittest to the best adapted? Why?
Reptile [31]

Answer:

The best to adapted because they already know how to survive through the toughest situations instead of being fit which leads them to nowhere but death

have a good day :)

Explanation:

6 0
3 years ago
Other questions:
  • How meiosis helps increase the genetic differences in babies?
    5·1 answer
  • What happens when the organic matter of the fossil is replaced by stone
    14·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • 1. ___________________ is a process of forming proteins based on a sequence of DNA. The first step of the process in which DNA i
    7·1 answer
  • Which statement about metamorphic and sedimentary rocks is true? Both types of rocks form under high temperature, but sedimentar
    9·2 answers
  • Which of the following cell types would be more closely related to a human cell? plant
    13·1 answer
  • Does anyone know a Patrick Hearn that lives in Bergman Arkansas? Please, if you do let me know, and let him know im looking for
    11·2 answers
  • Which best describes transduction bacteria
    12·2 answers
  • Drinking non-potable water can cause
    11·1 answer
  • A group of scientists determines that a mitochondrial DNA sequence shared by two species has a constant mutation rate. The seque
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!