1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
4 years ago
13

All infectious diseases are caused by bacteria.

Biology
1 answer:
Butoxors [25]4 years ago
8 0

Answer:

F

Explanation: some diseases are becuase your too overweight or FAT like heart diseases

You might be interested in
Why is calculating height from bone length useful to a forensic pathologist?
cluponka [151]
<span>By discovering height and length of a bone forensic experts are able </span>to tell the person’s weight, the racial group to which the person belongs. With other characteristics of the bones, the experts can discover age,  if the person was a male or female and what traumas suffered before.
8 0
3 years ago
Read 2 more answers
A(n) ____________ reaction occurs when the bonds of the reacting compounds are broken and new combinations are formed.
Step2247 [10]
An Exchange reaction
8 0
4 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Tortoise shells and snail shells are similar in function: they protect the organism from predators. Based on a comparison of the
andrezito [222]

The correct answer is D. Tortoises and snails have analogous organs, and they don't belong to the same species.

6 0
3 years ago
Read 2 more answers
What is cloning in plants? Please don't post inappropriate answers.​
lisabon 2012 [21]

Answer:

hope it helps..

Explanation:

This is a process of taking part of a healthy plant, replanting it, and having it grow. Since cloning is a form of asexual plant reproduction–meaning only one 'set' of DNA–the resulting clones are an exact replica of the parent plant.

3 0
3 years ago
Other questions:
  • Why does the reporter have a tube up his nose?
    8·1 answer
  • What is a relatively dense aggregation of fishes, squid, and other mesopelagic organisms capable of reflecting a sonar pulse tha
    15·1 answer
  • Which molecule is a source of carbon, hydrogen, and oxygen atoms for making proteins?
    10·1 answer
  • In London, peppered moths that were light colored blended in with trees of the area, and were well populated. Over time, polluti
    9·2 answers
  • Enzymes are an example of proteins. list some other types of proteins:
    8·1 answer
  • Can someone help me??
    8·1 answer
  • ....................................
    15·2 answers
  • Why do we shiver when we’re cold?
    6·2 answers
  • What roles do species plan in ecosystem?
    15·1 answer
  • What event is most likely to occur to the brain in a classic cerebral concussion?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!