1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
8

"of all the elements that occur on earth, how many are found in your body"

Biology
1 answer:
Oksanka [162]3 years ago
5 0
It is either 6 or 5. I can't remember but ik it's one of those two
You might be interested in
Alexander Fleming discovered a type of that kills bacteria, which led to the development of Penicillin.
blagie [28]

Answer:

mold juice

Explanation:

3 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Mr. Fuller assigned his science class a lab comparing the masses of objects to the nearest gram using a balance. The mass of a p
AleksAgata [21]
D) 20 should be correct

6 0
3 years ago
Which is the correct order of the food chain
Ugo [173]

Answer:

D. Sun > Grass > Mouse > Owl

Explanation:

the arrows show the flow of energy; in other words they show who is receiving the energy

8 0
3 years ago
Read 2 more answers
What role does base pairing play in the replication of dna ?
Naddik [55]

Answer:

It ensures that the two daughter molecules are exact copies of the parent molecule.

Explanation:

3 0
3 years ago
Other questions:
  • Emma bends and straightens her arms while lifting dumbbells. Which body systems work together to make this happen? Nervous and s
    11·2 answers
  • O help maintain homeostasis the respiratory system depends on the nervous system for signals to
    13·1 answer
  • Theory of macroeconomics dominated the Reagan administration.
    7·2 answers
  • Summarize how earth atmosphere and surface receive energy
    10·1 answer
  • Which end of a water molecule has a negative charge?
    10·2 answers
  • 80 points
    11·2 answers
  • An animal inherits a mutation in a gene that produces dark pigment proteins that are expressed in the animal’s skin tissue. If
    7·1 answer
  • En países con estaciones se puede apreciar que en otoño y en invierno, muchos
    5·1 answer
  • What process does a multi-cellular organism use to replace its damaged body cells
    14·2 answers
  • 1. warm weather forest biome; consists of plant layers including a canopy, understory, and forest floor.​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!