1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena55 [62]
3 years ago
12

summerize what happens in phase 1 and 2 of photosynthesis and describe where each phase occurs in the chloroplast.

Biology
1 answer:
Scilla [17]3 years ago
7 0
First Phase is when photosynthesis convert light eng. into a form called Chemical Energy in a form of known to man kind called ATP/NADPH which in turn is used to convert into glucose or sugar in Phase 2 = Calvin Cycle.

Second Phase is Calvin Cycle which has 3 divided stages which Carbon fixation, reduction, and regen of starting molecule. In turn NADPH is converted into Three-Carbon-Suger. 
You might be interested in
why is the diversity of living things in salt water greater than in fresh water? give as many reasons you can think of. will giv
Degger [83]

Answer:

For one thing, there's lots more of it. There are many more environmental niches to be occupied in salt-water bodies, and importantly, they're all connected, making it easier for species to migrate and adapt to new habitats. Conversely, fresh-water habitats are often more isolated, confining species to a single habitat and decreasing the likelihood that they'll be able to migrate and adapt.

Explanation:

6 0
2 years ago
How do scientists obtain knowledge about the world?
Sphinxa [80]
Well, scientists depend on science.They use the process of observation. But there are processes for these. The processes are;
Asking a question; Scientists wonder how specific happenings can be explained, they look for an answer.
They perform research; the scientists study the  particular thing, and look for reasons for a particular happening.
They form a hypothesis; a hypothesis is a statement which is not universally true, they are observations that haven't been agreed upon.
They test their hypothesis; they perform experiments to find out if their hypothesis is true.
They analyse the data and draw a conclusion; they record their hypothesis and write down their end result.
They pass across their result; they pass their new observation across to other people.
    Hope i helped. Have a nice day. 
7 0
2 years ago
Read 2 more answers
Explain how water changes state
ASHA 777 [7]

Answer:

so when its melted it's a liquid and then when it gets cold it freezes turning it to a solid and then when it evaporates it turns into a gas

6 0
2 years ago
What do you call the study of the connections between stress, the body's immune system, and illness?
Monica [59]
The correct answer is Psychoneuroimmunology.
Psychoneuroimmunology is known as the the study of the interplays among the psychological processes and the apprehensive and immune structures of the human body. The main goals of the study are the interactions among the nervous and immune structures and the relationships among mental procedures and fitness.
8 0
2 years ago
When a liquid is cooled, the kinetic energy of the particles(answer) . The force of attraction between the particles(answer) , t
Nataly_w [17]
The particles slow down
The space decreases
8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The brain is the center of all thoughts, perceptions, and emotions. <br> True or False
    10·2 answers
  • What is a Dihybrid cross?
    9·1 answer
  • Which type of diagram illustrates the flow of energy through a group of particular species?
    13·1 answer
  • ¿Cuales son los Estados de la materia? <br>Ayudenme por favor Es una Tarea ​
    6·1 answer
  • 5. How is density affected when the latitude increases?
    15·1 answer
  • Why was living in moist environments important for early land plants?
    7·1 answer
  • Which mechanism has the least effect on natural selection over time?
    12·1 answer
  • Which cells can form ATP by breaking down glucose?
    14·1 answer
  • What is a pig skin disease that people have pls help answer ASAP
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!