True...
it acts as a semi permeable membrane
Answer:
Proteins can be catalysts which help to reduce the energy used in a chemical reaction or speed it up. Proteins can help carry oxygen throughout the body in the form of hemoglobin
Explanation:
Answer:
Due to continuous global warming, the oceans tend to gain more heat and hence the temperature rises. In the current century, the heated conditions of the oceans can be threatful for the human population. Also, the increase in the sea levels will have serious consequences on the health of mankind and their quality of life.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved