1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
13

Translation of the DNA sequence AAGGGA would result in?

Biology
1 answer:
iragen [17]3 years ago
4 0

Answer:

UUCCCU

Explanation:

If you are translating into RNA, Adenine goes with Uracil and Guanine pairs up with Cytosine.

You might be interested in
PLEASE HELPPPPPPPPP
DanielleElmas [232]
True...
it acts as a semi permeable membrane
4 0
3 years ago
Describe how proteins can speed up chemical reactions and how they can help transport oxygen throughout the body.
Leni [432]

Answer:

Proteins can be catalysts which help to reduce the energy used in a chemical reaction or speed it up. Proteins can help carry oxygen throughout the body in the form of hemoglobin

Explanation:

4 0
3 years ago
In 3 to 5 sentences, analyze potential impacts of oceans on human populations as the result of climate change in the current cen
MrRissso [65]

Answer:

Due to continuous global warming, the oceans tend to gain more heat and hence the temperature rises. In the current century, the heated conditions of the oceans can be threatful for the human population. Also, the increase in the sea levels will have serious consequences on the health of mankind and their quality of life.

3 0
3 years ago
CAN I GET ANSWER OF 2 AND 4​
Marta_Voda [28]

Explanation:

2.spirogyra

4.porifera

7 0
2 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Other questions:
  • Instead of teeth whales in the suborder mysticeti have
    9·1 answer
  • The water cycle consists of some water evaporating from the surfaces of bodies of water and going into the air. As result of air
    13·1 answer
  • The method by which new genes can be acquired by successive generations:
    11·2 answers
  • Match the functions to the cell types ? Contraction and relaxation. Conducting electrochemical signals Fighting diseases Carryin
    12·1 answer
  • Carbohydrates contain many sugar molecules linked together.<br> a.simple<br> b.complex
    8·1 answer
  • Which of the following pathways of CO2 fixation is found in algae and green plants? a. the reverse citric acid cycle b. the 3-hy
    8·1 answer
  • Jill's class is studying how rocks are formed. Jill's teacher showed them a picture of a type of rock. Then, Jill's teacher made
    14·2 answers
  • What happens when something weathers over time?
    13·2 answers
  • The letters that make up the genetic code of DNA
    13·1 answer
  • Are all fungi eukariotic?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!