1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aniked [119]
3 years ago
6

List five reasons why being late or absent is a problem

Health
2 answers:
vlada-n [284]3 years ago
8 0
1. Giving back an assignment with a student that still hasn't passed it in could potentially make them cheat on it and hand it in.

2. The grade on the assignment will be affected once given late.

3. Habits can form and compile your work until you feel overwhelmed with assignments that are late.

4. Teachers particularly have to be impartial, but if you keep passing in late assignments, their opinion about you may reult in them thinking you're lazy.

5. Missing an assignment can affect if you can retake a quiz in the chapter, due to the assignment not being completed.
Valentin [98]3 years ago
7 0
1st reason is because you will miss information you might need for a assignment.
2nd reason is because you disrupt the classes attention
3rd reason is because you can get in trouble 
4th reason is because you can miss the homework for the night
5th you might forget to bring the due assignment to class
You might be interested in
This muscle sits below your lungs and helps you breath?
Vinil7 [7]

Answer:

D. Diaphragm is the muscle below our lungs that helps with respiration (breathing).

7 0
3 years ago
Read 2 more answers
Explain the digestion of food in the body system please
Brut [27]

Answer:

This process involves the mixing of food and breaking it down into small molecules this begins in the mouth and ends in the small intestines.

3 0
3 years ago
Read 2 more answers
According to Maslow's heirarchy of needs, explain what needs must be met in order for a person to reach self-actualization.
ziro4ka [17]
Maslow believes that a person must first satisfy lower needs before they'll be motivated to satisfy higher needs. The highest need in Maslow's hierarchy is the need for self-actualization. Before one can achieve this, one must satisfy all the lower needs first (physiological, safety, love/belongingness/self-esteem). 
3 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
4 years ago
How does diet affect diabetes
svlad2 [7]

Answer:

a diet high in fat, calories, and cholesterol increases your risk of diabetes. A poor diet can lead to obesity

3 0
3 years ago
Read 2 more answers
Other questions:
  • Complete each statement by choosing the correct answer from the drop-down menu.
    10·1 answer
  • Select the correct answer.
    6·1 answer
  • The generation called ___________ (born 1946-1964) has had a powerful impact on American society, giving us the cultural and sex
    11·1 answer
  • What type of triangle can a right triangle be?
    8·1 answer
  • The DASH diet is more effective in reducing blood pressure than just decreasing sodium alone because it includes which of the fo
    12·1 answer
  • What do you mean by chess?
    6·1 answer
  • What are two ways to help control the opioid overdose epidemic?
    14·2 answers
  • What is that called?
    15·2 answers
  • Read this excerpt from Elizabeth Loftus:
    15·1 answer
  • A typical _____ provides a continuum of housing arrangements and services, from independent living to assisted living and skille
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!