1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
3 years ago
5

Which kind of investigations never include a hypothesis?

Biology
1 answer:
Elden [556K]3 years ago
4 0

Discriptive investigation never include a hypothesis.

You might be interested in
Why is it that a virus that infects humans, is not likely to infect a dog or a cat?
LUCKY_DIMON [66]

Answer: Our immune systems are different and we come from different areas were exposure rates may be different.

Explanation:

6 0
3 years ago
Read 2 more answers
What property of water best Explains why the blue water moved up the celery stalk
kvasek [131]
Cohesion/adhesion - they help water act as if it were a "magnet"
8 0
3 years ago
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′
Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0
4 years ago
Membranes lining the body cavities that lack openings to the outside are called
vlabodo [156]
The answer is serous membranes.

Hope it helped!
6 0
4 years ago
____ is a scale that measures the acidity or basicity of a solution alonf a range of zero to 14
hodyreva [135]

Answer: oh yeah

Explanation:

i needed points

6 0
4 years ago
Read 2 more answers
Other questions:
  • Humans breathe through bronchi.
    10·2 answers
  • Why is it important to test both the left and right side during an mmt?
    13·1 answer
  • Recently, some crop plants were genetically modified to be immune to the effects of weed killers. Which of the environmental con
    9·2 answers
  • _______ is an elastic protein that connects tubulin doublets in cilia and flagellae. the resultant bridges play an important rol
    7·1 answer
  • My 1 year old got his first hit, for all the karens it was a fluck chill out dudeee
    9·2 answers
  • What natural Resource did the people of Ghana trade in order to obtain salt ?
    10·2 answers
  • What eats a parrotfish? Does a great white shark count‍♂️
    12·1 answer
  • please help ill give brainliest :)) The distance between two cities is 234 km and it takes me 5 hours to travel between these ci
    10·1 answer
  • Mention Some poisible solutions to control the spreading<br>exotic species?​
    11·1 answer
  • Tonicity scenario biology
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!