Answer: Our immune systems are different and we come from different areas were exposure rates may be different.
Explanation:
Cohesion/adhesion - they help water act as if it were a "magnet"
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
The answer is serous membranes.
Hope it helped!
