1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sunny_sXe [5.5K]
4 years ago
12

Which of these options represents the correct flow of events during meiosis II?Select one of the options below as your answer:

Biology
2 answers:
alina1380 [7]4 years ago
6 0
Ing meiosis 2, chromosomes will line up and sister chromatids will be separated by the fibers.
The one that represents the correct flow of events during meiosis II would be : A. sister chromatids pulled to opposite poles, nucleoli form, cytokinesis

hope this helps
almond37 [142]4 years ago
3 0
The option that represents the correct flow of events during meiosis II is A) sister chromatids pulled to opposite poles, nucleoi form, cytokinesis.
You might be interested in
Biology: which group contains only molecules that are each assembled from smaller organic compounds?
andrezito [222]
Number #3 :) dna fats and starch
3 0
3 years ago
True or false, biological evolution happens when changes in genetic makeup of a species occurs over time.
Dovator [93]

Answer:Evolution is a process that results in changes in the genetic material of a population over time. So its true!

Explanation:

This is correct!

8 0
3 years ago
The segregation of alleles occurs during:
DIA [1.3K]
<span>The segregation of alleles occurs during meiosis I or option C "meiosis." M</span>eiosis is<span> a specialized type of cell division that reduces the chromosome number by half. Which is where it separates the twenty-four chromosomes twelve from your Father twelve from your Mother.

Hope this helps!
</span>
5 0
3 years ago
Read 2 more answers
In the food chain below, which is the producer?<br><br> grass<br> mouse<br> snake<br> hawk
ivolga24 [154]

Answer:

Grass

Explanation:

Grass is the producer in the given food chain.

Note : -

Grasses are green plants which synthesize food ( carbohydrate ) in presence of sun light in the process of photosynthesis. That's why grass is called producers.

4 0
2 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Mrs. gray, a 50-year-old mother of seven children, is complaining of dull, aching pains in her legs. she reports that the pain h
    5·1 answer
  • Which type of fungi causes mold on bread?
    12·1 answer
  • An insect looks like a leaf, so it blends in with its surroundings and is hard for predators to see. The insect’s characteristic
    7·2 answers
  • How does the simple primary and secondary structure of dna hold the information needed to code for the many features of multicel
    12·1 answer
  • An alcoholic who believes that he is just being a typical college student and does not think his drinking is a problem is most l
    13·1 answer
  • Pancreatic hormones regulate blood glucose levels. identify two pancreatic hormones and describe the effect of each hormone on b
    10·1 answer
  • Plesiosaurs swam by using their paddle-like limbs in a manner similar to that of a
    7·1 answer
  • Which organism would MOST LIKELY be the main source of oxygen in a forest ecosystem
    5·2 answers
  • Active transport occurs in cells, for example, when the Na-K pump is at work. Any process that involves active transport most of
    10·2 answers
  • What part of the reproductive cycle is a virulent virus in?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!