1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
4 years ago
7

Please Help! What is the best name for the following compound?

Biology
2 answers:
elena-s [515]4 years ago
8 0

Answer: Option (b) is the correct answer.

Explanation:

The given compound CCl_{4} contains one carbon atom and there are four chlorine atoms.

According to IUPAC, name of cation will be written first and the name of anion will be written.

And due to the presence of four chlorine atoms a prefix "tetra" will be added before the name of anion.

Therefore, name of CCl_{4} is carbon tetrachloride.

DanielleElmas [232]4 years ago
4 0
Carbon tetrachloride that is the answer 
You might be interested in
What organism usually fixes nitrogen into usable chemical forms?
BigorU [14]
Bacteria found in the roots of legumes(beans) do nitrogen fixation.
4 0
3 years ago
PLEASE HELP!! 50 POINTS
dolphi86 [110]

Answer:

Males are XY(have one X chromosome) so, when it comes to X linked diseases, they express everything that is on that chromosome. They only need one copy. Females need 2 copies of the recessive allele in order to have the same condition.

4 0
4 years ago
How does the proximity to the sun affect a planet?
Burka [1]

Answer:

Generally, planets closer to the sun are rocky whereas planets further away are made of gasses because as the planets formed, the planets closer to the sun had their gasses were stripped away due to the heat of the sun, whereas planets slightly further away

Explanation:

5 0
3 years ago
Chimpanzees belong to the animal kingdom, and mushrooms belong to the fungus kingdom. What do they have in common?
olga55 [171]
I think they are both heterotrophs 

7 0
3 years ago
PLEASE HELPPPP DUE IN 5 MINUTESSS!!!! Leonardo bet his friend Olivet that two heterozygous green-eyed sea monsters could not hav
andre [41]
I think Leonardo could have a point but I’m pretty sure it’s just based on genetics even with sea monsters lol
5 0
3 years ago
Read 2 more answers
Other questions:
  • Oxytocin, which is synthesized in the hypothalamus, is secreted into the circulatory system of the body via the:
    14·1 answer
  • In general, the ______ system reacts more quickly than the endocrine system to maintain homeostasis.
    11·1 answer
  • carbon is removed from the atmosphere and put into food through photosynthesis respiration decomposition diffusion
    14·1 answer
  • What is the hardness of copper and aluminum
    9·1 answer
  • ________ occurs when precipitation lands on vegetation or other land cover before reaching the surface.
    7·1 answer
  • You are to create a story for a child of 5-6 years old. You will explain the brain and its functions to them. You need to use th
    6·1 answer
  • All you need is in the photo ​
    10·1 answer
  • During receiving of a food order, you notice a bag of rice with signs that the bag has been wet. What do you do?
    7·1 answer
  • A negative ion will attract
    11·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!