1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
4 years ago
15

PLEASE HELP ASAP‼️

Biology
1 answer:
sattari [20]4 years ago
7 0
When a researcher make treatments to help others or something he/she must test it maybe on someone ( if the person is willing to of course ) or an object and then take records to know where he /she was wrong and must correct .
The the answer is test / examine / analyse
You might be interested in
PLEASE PLEASE HURRY
aliya0001 [1]

Explanation:

the release of an egg from the ovary

6 0
2 years ago
The rectus abdominis is classified as a convergent muscle. <br> a. True <br> b. False
Fofino [41]
The rectus abdominis is not classified as a convergent muscle


7 0
3 years ago
Read 2 more answers
The density and concentration of a given area __________.
defon
<span>Vary depending on the distribution of the given feature.</span>
3 0
4 years ago
Please help it’s a semester test please help I need help giving brainliest
OleMash [197]
Ok I will help what’s up
6 0
3 years ago
Read 2 more answers
A learned predisposition to respond cognitively, affectively, and behaviorally to a particular object is known as _____.
RSB [31]

Answer:

Attitude

Explanation:

Attitude is the learned predisposition to respond cognitively, affectively, and behaviorally to a particular object. Its a disposition for approaching any particular idea or thought or any kind of event or person. Its a kind of act towards these approaches. Attitude can be both negative or positive. In case of good feelings, vibes and emotions the attitude is positive else it is said to be negative.

4 0
3 years ago
Other questions:
  • A student is observing different structures of a seed plant during a lab activity. She has identified tiny structures that look
    8·1 answer
  • Four different thermometers were used to measure the temperature of a sample of pure boiling water. The measurements are recorde
    10·1 answer
  • Average year-after-year conditions are to climate as to day-to-day atmospheric conditions are to
    9·2 answers
  • The mitochondrial membrane is made of ____ , and the ribosome is made of _____.
    7·2 answers
  • Greenhouse gases trap
    11·2 answers
  • Describe the relationship between the cytoplasm and the nucleus of a cell
    10·1 answer
  • Draw the structure of DNA aand write a short note about it.​
    10·1 answer
  • Read the scenario below and answer the questions that follow for 2 points each: Two Siamese and three Persian cats survive a shi
    11·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • 7. How do dissolved minerals help in the formation of sedimentary rock?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!