1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lakkis [162]
3 years ago
15

HOW DO FOOD CHAINS RELATE TO FOOD WEBS: A.Food chains explain the type of animals found in the ecosystem B.Multiple food chains

make up a food web of an ecosystem C.Food webs and food chains are used to represent only animals in the ecosystem D.Food webs make up multiple food chains.​
Biology
1 answer:
koban [17]3 years ago
6 0

The answer is B. Multiple food chains make up a food web of an ecosystem. A food web is made up of multiple food chains, and shows the relationships between different organisms in an ecosystem.

You might be interested in
What is an anatomical features shared by bats bears and beluga whales that provides evidence of their common descent?
ArbitrLikvidat [17]

Answer:

The types of DNA and the bones structure

Explanation:

bc many of these animals had descends of other animals and we can see it by the bone structure that they are almost the same

7 0
3 years ago
QUESTION 4
CaHeK987 [17]

Correlational study is used to show the type of association or relationship which exists between two or more variables using statistical analysis. Ken's research shows that <em>there</em><em> </em><em>is</em><em> </em><em>a</em><em> </em><em>relationship</em><em> </em><em>between</em><em> </em><em>childhood</em><em> </em><em>anger</em><em> </em><em>management</em><em> </em><em>and</em><em> </em><em>adult</em><em> </em><em>earning</em><em>.</em><em> </em>

  • According to Ken's research, learning how to control anger leads to making more income during adulthood. This signifies a positive relationship between good anger management in childhood and earning made during adulthood.

  • Similarly poor anger management in childhood leads is associated with low earning during adulthood.

  • Hence, Ken's research shows that there is a relationship between <em>childhood</em><em> </em><em>anger</em><em> </em><em>management</em><em> </em><em>and</em><em> </em><em>adult</em><em> </em><em>earnings</em><em>.</em><em> </em>

<em>Learn</em><em> </em><em>more</em><em> </em><em>:</em><em> </em><em>brainly.com/question/17561092?referrer=searchResults</em>

8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which of the following best describes the logic of scientific inquiry?
beks73 [17]

Answer:

d. if my hypothesis is correct, I can expect certain test results

Explanation:

To create a theory is not enough to state an assumption. Called scientific research, the practice tries, through a logical procedure, to produce tested, proven and safe scientific knowledge. This concept is based on the logic of scientific research that states that a hypothesis must be tested, because if the hypothesis is correct, certain test results can be expected. For this, some rules or phases are part of the process. And they are: observation, hypotheses, research method and conclusion.

Thus, we can conclude that among the alternatives presented, the one that best describes the logic of scientific investigation is the letter D.

4 0
3 years ago
Using both maps, what can you tell about the regions in Washington that get the most or the least amount of rain?
lidiya [134]

Answer:

In the Precipitation Map of Washington, the dark orange section indicates low rainfall in the region. Using the Shaded Relief Map of Washington, you can tell that this area is flat, possibly a plain. These regions typically don't receive a lot of rain. The Precipitation Map of Washington has areas that are dark purple and dark green. This indicates that they both receive a lot of rainfall every year. If you look at these areas on the Shaded Relief Map of Washington, you can tell that these areas with a lot of rainfall are mountainous.  

On the Precipitation Map of Washington, purple/blue means more rain, and orange/red means less rain. The Shaded Relief Map of Washington shows mountains (brown), valleys, plateaus, and canyons. Areas that are flat are smooth on the map. Areas with steep slopes and mountains look rougher.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Select the correct statement regarding nerve cells.
    13·1 answer
  • What basic life processes must all unicellular organisms<br> perform in order to survive?
    11·1 answer
  • Two plants are crossed, resulting in offspring with a 3:1 ratio for a particular trait. this ratio suggests that _____.
    12·2 answers
  • What new characteristic did John Dalton add to the model of the atom?
    15·2 answers
  • A thin, flexible, semipermeable barrier around the cell which regulates what enters and leaves the cell.
    8·2 answers
  • they went home and found that their mother is using a plunger because the kitchen is blocked.They have two diffrent size of plun
    13·1 answer
  • In the large intestine material is stored how many<br>hours prior to elimination?​
    12·2 answers
  • Solve the system of equations.
    8·2 answers
  • Are alternative energy types renewable or nonrenewable​
    5·1 answer
  • which of the following is true of reproduction? A.only small organisms have a high chance to reproduce B.only large organisms ha
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!