1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Murrr4er [49]
3 years ago
5

Negatives about gypsy moths?

Biology
2 answers:
Alexus [3.1K]3 years ago
8 0

Answer:

The rise of the gypsy moth population will eventually kill many trees, as they won’t be able to perform photosynthesis. This event will negatively affect the lumber and construction industries, as well as the beauty of public and private landscapes.

Explanation:

PLATO

elena55 [62]3 years ago
5 0

Answer:

Gypsy moths do not kill trees directly they defoliate them. Severe defoliation can add to other stresses such as weather extremes or human activities. This cumulative stress can leave trees vulnerable to disease or other pest infestation that can cause death.

Explanation:

I HOPE THIS HELPED YOU PLEASE MARK ME AS BRAINLIEST

You might be interested in
Structure in female where fertilization occurs
Lera25 [3.4K]
Fertilization occurs in the fallopian tubes
4 0
3 years ago
Physical and cognitive abnormalities in children that are the result of a pregnant woman's heavy drinking are known as
notsponge [240]
I think it's FAS or Fetal Alcohol Syndrome
7 0
3 years ago
What are hormones explain??​
Alexxandr [17]

Answer:

Hormones are chemical messengers that are secreted directly into the blood, which carries them to organs and tissues of the body to exert their functions. There are many types of hormones that act on different aspects of bodily functions and processes.

8 0
3 years ago
Read 2 more answers
During the process of fertilization, which step happens first? A. The sperm's nucleus enters the egg cell. B. Enzymes break down
Tpy6a [65]
The first step I believe is B. Enzymes break down the protective layer of the egg cell.
5 0
3 years ago
Read 2 more answers
How to gain teens trust for medical reasons?
wolverine [178]
Become there friends and gain there trust by expressing your personal experiences
8 0
3 years ago
Other questions:
  • What specialized cells serve and protect the body from injuries and diseases?
    8·2 answers
  • What occurs before the hypothesis?
    10·2 answers
  • What types of health related issues might be associated with climate related factors?
    10·1 answer
  • What happens when light strikes green plant pigments?
    9·2 answers
  • Choose the letters below for their proper places on the Punnett Square. Cross a smooth hybrid pea with another smooth hybrid pea
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Water plant siver gold. Which of these materials are minerals?
    13·2 answers
  • Suggest some method to<br>presevining forest habitan​
    9·1 answer
  • For the year 2008, the fao estimated that every person on the planet consumed at least _____ percent of their animal protein int
    10·2 answers
  • Why is it important to center the object you want to look at in your field of view before changing to a higher magnification obj
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!