1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
13

3. What types of damage can introduced species cause?

Biology
1 answer:
marysya [2.9K]3 years ago
5 0

Answer: They can change an entire habitat, placing ecosystems at risk, crowd out or replace native species that are beneficial to a habitat, and damage human enterprise, such as fisheries, costing the economy millions of dollars.

Explanation:

You might be interested in
What is a single population is made of? a. multiple organisms. b. multiple species. c. multiple communities. d. multiple biomes.
Alexandra [31]
A. Multiple organisms 
3 0
3 years ago
Read 2 more answers
Point source pollution comes from sources that are___.
Vilka [71]
C. Basically unknown
5 0
3 years ago
Read 2 more answers
Can someone help me please ahhhh omggggg please please
expeople1 [14]

Answer:

b

Explanation:

jskskdjdkdnemebembskeje

4 0
3 years ago
What are the smallest objects that biologists study
likoan [24]

The smallest thing they study is cells, i think!

hoped this helped!!

7 0
3 years ago
Read 2 more answers
Help Resc
erica [24]

Answer:

The answer is option B

The equator of the cell.

Hope this helps.

3 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why can the complex sugar cellulose store more energy than the sugar glucose?
    7·1 answer
  • Which type of growth can occur only when a population has unlimited resources?
    10·2 answers
  • Why are ameobas animal like protists likely to use endocytosis
    14·1 answer
  • Organisms can be ______________, where they are composed of only 1 cell, or they can be __________ where they are composed of ma
    10·1 answer
  • 1.
    7·2 answers
  • Rachel Carson was one of the first ecologists to warn against the widespread use
    6·1 answer
  • 14. Which nitrogenous base isn't found in DNA?
    7·2 answers
  • How can structures for movement help protists to survive
    15·2 answers
  • From the top of a 10 foot tall basketball hoop, the measure of the angle of depression to the athlete's shoe is 27 degrees. How
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!